ID: 1194937740

View in Genome Browser
Species Human (GRCh38)
Location X:99971124-99971146
Sequence AGGGAGAGCACAATTATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194937740_1194937750 27 Left 1194937740 X:99971124-99971146 CCCACAATAATTGTGCTCTCCCT No data
Right 1194937750 X:99971174-99971196 TGCTGCATTGCCACTGCTGTGGG No data
1194937740_1194937751 28 Left 1194937740 X:99971124-99971146 CCCACAATAATTGTGCTCTCCCT No data
Right 1194937751 X:99971175-99971197 GCTGCATTGCCACTGCTGTGGGG No data
1194937740_1194937749 26 Left 1194937740 X:99971124-99971146 CCCACAATAATTGTGCTCTCCCT No data
Right 1194937749 X:99971173-99971195 ATGCTGCATTGCCACTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194937740 Original CRISPR AGGGAGAGCACAATTATTGT GGG (reversed) Intergenic
No off target data available for this crispr