ID: 1194938337

View in Genome Browser
Species Human (GRCh38)
Location X:99978970-99978992
Sequence AGAGCCTAGAGGGGTAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194938337_1194938345 15 Left 1194938337 X:99978970-99978992 CCCTCTTTACCCCTCTAGGCTCT No data
Right 1194938345 X:99979008-99979030 CCACAGCTCCCTATCCAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194938337 Original CRISPR AGAGCCTAGAGGGGTAAAGA GGG (reversed) Intergenic
No off target data available for this crispr