ID: 1194938345

View in Genome Browser
Species Human (GRCh38)
Location X:99979008-99979030
Sequence CCACAGCTCCCTATCCAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194938339_1194938345 6 Left 1194938339 X:99978979-99979001 CCCCTCTAGGCTCTCACACCTCT No data
Right 1194938345 X:99979008-99979030 CCACAGCTCCCTATCCAATCAGG No data
1194938341_1194938345 4 Left 1194938341 X:99978981-99979003 CCTCTAGGCTCTCACACCTCTGT No data
Right 1194938345 X:99979008-99979030 CCACAGCTCCCTATCCAATCAGG No data
1194938335_1194938345 26 Left 1194938335 X:99978959-99978981 CCATGCAGATGCCCTCTTTACCC No data
Right 1194938345 X:99979008-99979030 CCACAGCTCCCTATCCAATCAGG No data
1194938340_1194938345 5 Left 1194938340 X:99978980-99979002 CCCTCTAGGCTCTCACACCTCTG No data
Right 1194938345 X:99979008-99979030 CCACAGCTCCCTATCCAATCAGG No data
1194938338_1194938345 14 Left 1194938338 X:99978971-99978993 CCTCTTTACCCCTCTAGGCTCTC No data
Right 1194938345 X:99979008-99979030 CCACAGCTCCCTATCCAATCAGG No data
1194938334_1194938345 30 Left 1194938334 X:99978955-99978977 CCTGCCATGCAGATGCCCTCTTT No data
Right 1194938345 X:99979008-99979030 CCACAGCTCCCTATCCAATCAGG No data
1194938337_1194938345 15 Left 1194938337 X:99978970-99978992 CCCTCTTTACCCCTCTAGGCTCT No data
Right 1194938345 X:99979008-99979030 CCACAGCTCCCTATCCAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194938345 Original CRISPR CCACAGCTCCCTATCCAATC AGG Intergenic
No off target data available for this crispr