ID: 1194940415

View in Genome Browser
Species Human (GRCh38)
Location X:100002658-100002680
Sequence TCACAGAAGCAGACAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194940413_1194940415 6 Left 1194940413 X:100002629-100002651 CCTGTGTGTGAAATCTAAAATTG No data
Right 1194940415 X:100002658-100002680 TCACAGAAGCAGACAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194940415 Original CRISPR TCACAGAAGCAGACAGTGGA AGG Intergenic
No off target data available for this crispr