ID: 1194940482

View in Genome Browser
Species Human (GRCh38)
Location X:100003598-100003620
Sequence AGGGAGGACCATAATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194940482_1194940485 -5 Left 1194940482 X:100003598-100003620 CCATCCTCATTATGGTCCTCCCT No data
Right 1194940485 X:100003616-100003638 TCCCTCCTCTGAATACTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194940482 Original CRISPR AGGGAGGACCATAATGAGGA TGG (reversed) Intergenic
No off target data available for this crispr