ID: 1194942139

View in Genome Browser
Species Human (GRCh38)
Location X:100023822-100023844
Sequence GCAGTGAAGCTGTTGGATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194942139_1194942141 4 Left 1194942139 X:100023822-100023844 CCATGATCCAACAGCTTCACTGC No data
Right 1194942141 X:100023849-100023871 TTGTACCAAACATTTAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194942139 Original CRISPR GCAGTGAAGCTGTTGGATCA TGG (reversed) Intergenic
No off target data available for this crispr