ID: 1194944190

View in Genome Browser
Species Human (GRCh38)
Location X:100048613-100048635
Sequence GCAGGTGAACAGAAGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194944183_1194944190 12 Left 1194944183 X:100048578-100048600 CCAAGCCTTGGTGGCTTCCACAT 0: 66
1: 155
2: 608
3: 1044
4: 1600
Right 1194944190 X:100048613-100048635 GCAGGTGAACAGAAGGCAGAAGG No data
1194944186_1194944190 -5 Left 1194944186 X:100048595-100048617 CCACATGGTGTTGAGCCTGCAGG 0: 97
1: 302
2: 752
3: 1154
4: 1597
Right 1194944190 X:100048613-100048635 GCAGGTGAACAGAAGGCAGAAGG No data
1194944181_1194944190 14 Left 1194944181 X:100048576-100048598 CCCCAAGCCTTGGTGGCTTCCAC 0: 64
1: 278
2: 1019
3: 1782
4: 1788
Right 1194944190 X:100048613-100048635 GCAGGTGAACAGAAGGCAGAAGG No data
1194944185_1194944190 7 Left 1194944185 X:100048583-100048605 CCTTGGTGGCTTCCACATGGTGT 0: 90
1: 233
2: 827
3: 1237
4: 1923
Right 1194944190 X:100048613-100048635 GCAGGTGAACAGAAGGCAGAAGG No data
1194944180_1194944190 15 Left 1194944180 X:100048575-100048597 CCCCCAAGCCTTGGTGGCTTCCA No data
Right 1194944190 X:100048613-100048635 GCAGGTGAACAGAAGGCAGAAGG No data
1194944182_1194944190 13 Left 1194944182 X:100048577-100048599 CCCAAGCCTTGGTGGCTTCCACA 0: 58
1: 155
2: 646
3: 1082
4: 1735
Right 1194944190 X:100048613-100048635 GCAGGTGAACAGAAGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194944190 Original CRISPR GCAGGTGAACAGAAGGCAGA AGG Intergenic
No off target data available for this crispr