ID: 1194946714

View in Genome Browser
Species Human (GRCh38)
Location X:100077271-100077293
Sequence CTCTTCCTGGATCTTGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194946714_1194946718 26 Left 1194946714 X:100077271-100077293 CCAGGCTCAAGATCCAGGAAGAG No data
Right 1194946718 X:100077320-100077342 CAGAAAAAGACCAGTGTTCCAGG No data
1194946714_1194946717 3 Left 1194946714 X:100077271-100077293 CCAGGCTCAAGATCCAGGAAGAG No data
Right 1194946717 X:100077297-100077319 ACATTTAAGTTCAAGTCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194946714 Original CRISPR CTCTTCCTGGATCTTGAGCC TGG (reversed) Intergenic
No off target data available for this crispr