ID: 1194947146

View in Genome Browser
Species Human (GRCh38)
Location X:100082770-100082792
Sequence CTCACTCCATTCCAAAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194947142_1194947146 -5 Left 1194947142 X:100082752-100082774 CCTAGGTTTCCACTCCCACTCAC No data
Right 1194947146 X:100082770-100082792 CTCACTCCATTCCAAAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194947146 Original CRISPR CTCACTCCATTCCAAAGAAC TGG Intergenic
No off target data available for this crispr