ID: 1194947944

View in Genome Browser
Species Human (GRCh38)
Location X:100091309-100091331
Sequence TGGGCAGGACCTCCCAACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194947936_1194947944 -2 Left 1194947936 X:100091288-100091310 CCTGATCTCATTCCTCCTCACTG No data
Right 1194947944 X:100091309-100091331 TGGGCAGGACCTCCCAACAGGGG No data
1194947934_1194947944 22 Left 1194947934 X:100091264-100091286 CCAGATTGCTTTTATACACAGGT No data
Right 1194947944 X:100091309-100091331 TGGGCAGGACCTCCCAACAGGGG No data
1194947935_1194947944 -1 Left 1194947935 X:100091287-100091309 CCCTGATCTCATTCCTCCTCACT No data
Right 1194947944 X:100091309-100091331 TGGGCAGGACCTCCCAACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194947944 Original CRISPR TGGGCAGGACCTCCCAACAG GGG Intergenic
No off target data available for this crispr