ID: 1194958430

View in Genome Browser
Species Human (GRCh38)
Location X:100208116-100208138
Sequence CTGGCCTATCTGCCTCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194958430_1194958432 -10 Left 1194958430 X:100208116-100208138 CCACCTGGAGGCAGATAGGCCAG No data
Right 1194958432 X:100208129-100208151 GATAGGCCAGCTGTAAACTCAGG No data
1194958430_1194958435 4 Left 1194958430 X:100208116-100208138 CCACCTGGAGGCAGATAGGCCAG No data
Right 1194958435 X:100208143-100208165 AAACTCAGGTTTAGGATTCCAGG No data
1194958430_1194958434 -4 Left 1194958430 X:100208116-100208138 CCACCTGGAGGCAGATAGGCCAG No data
Right 1194958434 X:100208135-100208157 CCAGCTGTAAACTCAGGTTTAGG No data
1194958430_1194958436 18 Left 1194958430 X:100208116-100208138 CCACCTGGAGGCAGATAGGCCAG No data
Right 1194958436 X:100208157-100208179 GATTCCAGGCACAGCCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194958430 Original CRISPR CTGGCCTATCTGCCTCCAGG TGG (reversed) Intergenic
No off target data available for this crispr