ID: 1194959947

View in Genome Browser
Species Human (GRCh38)
Location X:100223780-100223802
Sequence CAGGCTGCAGAGGCTGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194959947_1194959953 21 Left 1194959947 X:100223780-100223802 CCTCCTACAGCCTCTGCAGCCTG No data
Right 1194959953 X:100223824-100223846 CACCATCAAAACCATTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194959947 Original CRISPR CAGGCTGCAGAGGCTGTAGG AGG (reversed) Intergenic
No off target data available for this crispr