ID: 1194966737

View in Genome Browser
Species Human (GRCh38)
Location X:100296898-100296920
Sequence CAATTTCATCAGCTTTTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 274}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194966736_1194966737 12 Left 1194966736 X:100296863-100296885 CCTTCATTCTGATCTGTTTGGAA 0: 1
1: 0
2: 1
3: 16
4: 278
Right 1194966737 X:100296898-100296920 CAATTTCATCAGCTTTTCCCAGG 0: 1
1: 0
2: 0
3: 28
4: 274
1194966733_1194966737 26 Left 1194966733 X:100296849-100296871 CCCGGCAATGAAATCCTTCATTC 0: 1
1: 0
2: 0
3: 11
4: 148
Right 1194966737 X:100296898-100296920 CAATTTCATCAGCTTTTCCCAGG 0: 1
1: 0
2: 0
3: 28
4: 274
1194966734_1194966737 25 Left 1194966734 X:100296850-100296872 CCGGCAATGAAATCCTTCATTCT 0: 1
1: 0
2: 2
3: 23
4: 260
Right 1194966737 X:100296898-100296920 CAATTTCATCAGCTTTTCCCAGG 0: 1
1: 0
2: 0
3: 28
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194966737 Original CRISPR CAATTTCATCAGCTTTTCCC AGG Intronic
903115975 1:21178263-21178285 CAATTTTCTCAGCTTTTCTGTGG - Intergenic
903122282 1:21224140-21224162 CATTTTCCCCAGCTTTTCCCAGG + Intronic
904141024 1:28353196-28353218 CCACTTCATCTGCTTTTACCTGG - Intergenic
905848562 1:41256046-41256068 CATTATCATCAGATTTTCCAAGG - Intergenic
906722958 1:48022705-48022727 CAATTTCCCCATCTTTTCCATGG + Intergenic
908266772 1:62386989-62387011 CCATTTCATCAGAATTTCCATGG - Intergenic
908565458 1:65351182-65351204 CAATTGCTCCAGCTTTTGCCTGG - Intronic
909696357 1:78472148-78472170 ACATTTCATCAGCAATTCCCAGG - Intronic
910207191 1:84759715-84759737 ATACTTAATCAGCTTTTCCCTGG + Intergenic
910402119 1:86847708-86847730 CAATATCTTGAGTTTTTCCCAGG + Intergenic
910442974 1:87271865-87271887 CTATTTCATGAGCCTTTCACGGG + Intergenic
910623139 1:89277841-89277863 CCATTTCAGCAGCTTTGCACAGG + Intergenic
910746567 1:90581237-90581259 CAATTTCATTTTCTTTTCACTGG - Intergenic
911008291 1:93251481-93251503 AAATTTCCTCAGCTTTTCTTTGG + Intronic
911040082 1:93584432-93584454 CCAGTTCATCAGATTTTCCCGGG - Intronic
911499111 1:98663489-98663511 CAATTTCATTAGCTTCACCTTGG - Intronic
911784497 1:101929008-101929030 AATTTTCATCAGAATTTCCCAGG - Intronic
912546395 1:110454465-110454487 CAGTTTCCTCAGCATTGCCCAGG - Intronic
915973234 1:160368302-160368324 CCCTTTCCCCAGCTTTTCCCAGG + Intronic
918190084 1:182165145-182165167 TCATTTCATGTGCTTTTCCCTGG - Intergenic
920758207 1:208755675-208755697 TAATTCCAACAGCTTTTCACTGG + Intergenic
920897365 1:210067770-210067792 CTATATTATCAGCTTTTCCTAGG - Intronic
921268408 1:213445515-213445537 GAATTTCATCAGTTTCTCCCTGG - Intergenic
921294337 1:213688076-213688098 CCCTTTCTTCAGCTTTGCCCAGG + Intergenic
922535976 1:226381304-226381326 TATTTTCATAGGCTTTTCCCAGG - Intronic
924246442 1:242090312-242090334 CATTTTCTTCAGCTTTGCTCCGG + Intronic
924291310 1:242539358-242539380 TAATTTCATCTCCTTTTCTCTGG - Intergenic
1064784058 10:18874783-18874805 CAATGTCCCCAGCTTTTCCATGG - Intergenic
1067407231 10:46033991-46034013 GACTTTCATCAGCTTCTCCCTGG - Intronic
1068570333 10:58621098-58621120 AAATTTCATTAGATTTTCCCTGG - Intronic
1069082060 10:64099195-64099217 CAATTTCCTGAGGTTGTCCCTGG + Intergenic
1070436020 10:76394373-76394395 CAAATTCTTCTGCTTTTCACTGG + Intronic
1073873620 10:107895954-107895976 CAACTTCCTCAGCTTTTGTCTGG + Intergenic
1074825483 10:117212441-117212463 GAATTTCCTCAGCTTTTGTCTGG - Intergenic
1075249880 10:120858049-120858071 GAATTTAATCAGATTTGCCCTGG + Intronic
1075934750 10:126330471-126330493 CAACTTCATCAGCTCTTCCTTGG + Exonic
1079576850 11:22014642-22014664 CAATTTCCTCATGTTTTTCCAGG - Intergenic
1080298441 11:30756779-30756801 CAATTTCATCAAATTCTCTCAGG - Intergenic
1081403281 11:42667095-42667117 CATTTTCCTTATCTTTTCCCTGG - Intergenic
1081715744 11:45248867-45248889 CAATTTCAACACCTGCTCCCTGG + Intronic
1081957885 11:47109366-47109388 CAATTTCTTCTGCTTGTCCTCGG - Intronic
1083025638 11:59548436-59548458 CAATTTCATCATCTTTTTGGGGG - Intergenic
1083146191 11:60760857-60760879 CAATTTCTTTAGCTGTCCCCAGG - Intronic
1084311977 11:68322327-68322349 CAATGACATCAGCTTTTACTTGG + Intronic
1085042180 11:73333085-73333107 TAATTTCATGAGCTCTTCCGTGG - Intronic
1085379289 11:76098620-76098642 CAAATCAATCAGCTTTTCCAAGG - Intronic
1086948395 11:92866860-92866882 CAATTTCACGAGCCTGTCCCTGG + Exonic
1088682043 11:112251819-112251841 GAATTTCCACAGCTTTTCACAGG - Intronic
1089018647 11:115188233-115188255 CAATTACATCTGCTCTTTCCTGG - Intronic
1089922466 11:122222700-122222722 CAATTTCATAAACCTTTCCCAGG - Intergenic
1090204491 11:124877015-124877037 CCATTTCATCAGAATTTCTCGGG - Intronic
1090496508 11:127217890-127217912 CTATTTCATTAGTATTTCCCAGG - Intergenic
1092128097 12:6089415-6089437 CAGTTTTTTCAGCTGTTCCCAGG + Intronic
1094044812 12:26155769-26155791 CACTTTGCTAAGCTTTTCCCAGG + Intronic
1095961816 12:47839641-47839663 CAATTTCCCCAGCTTCTACCAGG - Intergenic
1096096612 12:48939709-48939731 CATTCTCATCAGCTCTTCCCGGG + Exonic
1096833239 12:54330881-54330903 CATCTTCATCAGCTGTCCCCTGG - Intronic
1097521010 12:60671236-60671258 CAAAATCATCAGATTTTCCCAGG - Intergenic
1097733969 12:63160867-63160889 CAATTTCATAAGATTTTGTCGGG - Intergenic
1100006251 12:89899311-89899333 CAATTTCAGCTGCCTTTTCCAGG + Intergenic
1101565617 12:105902187-105902209 CAACCTCATGGGCTTTTCCCTGG + Intergenic
1103363145 12:120365861-120365883 CAATCACACCCGCTTTTCCCAGG + Intronic
1104114091 12:125732480-125732502 CATTTTCCTGAGCTTCTCCCTGG - Intergenic
1104338261 12:127921499-127921521 AAACTTTATCAGCTTTTCCCTGG - Intergenic
1105428515 13:20316192-20316214 CAAATTCATCATCCTCTCCCTGG - Intergenic
1106307265 13:28524056-28524078 CAATTTCTTCAGTATTTCCCAGG + Intergenic
1107566304 13:41608746-41608768 CTATTTCATTTGCTTTTCACTGG + Intronic
1107990567 13:45815414-45815436 CTATAGCATCAGCTCTTCCCTGG + Intronic
1108824008 13:54389667-54389689 CAAATTCCTGAGCCTTTCCCAGG + Intergenic
1110184404 13:72656448-72656470 AAGCTGCATCAGCTTTTCCCTGG - Intergenic
1110491706 13:76117696-76117718 AAAATTCTGCAGCTTTTCCCGGG - Intergenic
1110644953 13:77871862-77871884 CACTTTCAACAGCATTCCCCAGG - Intergenic
1111171025 13:84527061-84527083 CATTTTCAGAAGCTTTTCCCCGG - Intergenic
1113635631 13:111917135-111917157 TGCTTTCATCAGCTCTTCCCTGG + Intergenic
1114479557 14:23024089-23024111 CAATTTGAACACCTCTTCCCTGG - Intronic
1115006161 14:28487815-28487837 GAATTTCATCAGCTTTTTCATGG - Intergenic
1115388065 14:32820907-32820929 CATTTTAAGCAGCTTTTGCCTGG - Intronic
1116147781 14:41098432-41098454 CATTCTCATCAGTTTCTCCCTGG + Intergenic
1116769869 14:49114787-49114809 CAATTACATAATCATTTCCCGGG + Intergenic
1118777388 14:68981251-68981273 CACTTTCTTCACCTTTTCCATGG - Intergenic
1120238785 14:81925312-81925334 CATTCTCCTCTGCTTTTCCCTGG + Intergenic
1121874075 14:97434993-97435015 CATTTGCATCATCTTTTGCCAGG - Intergenic
1123918004 15:25051508-25051530 CATTTTGTTCAGCTTTTCCAAGG - Intergenic
1123918446 15:25054241-25054263 CATTTTGTTCAGCTTTTCCAAGG - Intergenic
1123918896 15:25056891-25056913 CATTTTGTTCAGCTTTTCCAAGG - Intergenic
1123919333 15:25059570-25059592 CATTTTGTTCAGCTTTTCCAAGG - Intergenic
1123919807 15:25062364-25062386 CATTTTGTTCAGCTTTTCCAAGG - Intergenic
1123920245 15:25065058-25065080 CATTTTGTTCAGCTTTTCCAAGG - Intergenic
1123920693 15:25067819-25067841 CATTTTGTTCAGCTTTTCCAAGG - Intergenic
1123921105 15:25070463-25070485 CATTTTGTTCAGCTTTTCCAAGG - Intergenic
1123921527 15:25073138-25073160 CATTTTGTTCAGCTTTTCCAAGG - Intergenic
1124375324 15:29125857-29125879 CGTTTTCAGCAGCATTTCCCAGG - Intronic
1127333083 15:57957464-57957486 CAATTTCACCATCTTGTTCCAGG + Intronic
1127724312 15:61733432-61733454 CAATCTCATAATCTTTTCACTGG + Intergenic
1130256188 15:82327172-82327194 CAATTTCATCAGCTTCCACGAGG + Intergenic
1130598765 15:85262814-85262836 CAATTTCATCAGCTTCCACGAGG - Intergenic
1131141562 15:89980656-89980678 CAAATGAAACAGCTTTTCCCAGG + Intergenic
1131591968 15:93759653-93759675 AAATTTCACCAGCTTTTCTGAGG - Intergenic
1133470987 16:6075282-6075304 CATTTTCATCTACTTTTCCAGGG + Intronic
1134237288 16:12477061-12477083 CTGTTTCATCAGCTTTTTGCAGG - Intronic
1134263878 16:12676112-12676134 CACTCTCATCAGAATTTCCCTGG + Intronic
1134442738 16:14308867-14308889 TATTTTCATCAGCATTTCCAAGG + Intergenic
1135854738 16:25997705-25997727 CAAATTAGTCAACTTTTCCCAGG + Intronic
1139159697 16:64489586-64489608 CAATATCTTAAGCTTATCCCTGG + Intergenic
1139284021 16:65794757-65794779 GACTTCCATAAGCTTTTCCCTGG - Intergenic
1140042477 16:71417586-71417608 CATTTTGGTCAGTTTTTCCCTGG + Intergenic
1141467492 16:84215971-84215993 CAATTTCATCAGCTTCTCAAAGG - Intergenic
1144041920 17:11419780-11419802 CATTTCCACCACCTTTTCCCTGG + Intronic
1147603978 17:41763606-41763628 CCAACTCATCAGCCTTTCCCTGG + Intronic
1149435996 17:56633960-56633982 AAATGTCATCAGTTTCTCCCTGG + Intergenic
1152231438 17:79115847-79115869 TATTTTCAGCAGCCTTTCCCCGG + Intronic
1153194006 18:2572848-2572870 CAAGATCATCATCTTTCCCCTGG - Intronic
1153271232 18:3323714-3323736 CATTTTCACCAACTATTCCCAGG - Intergenic
1155113643 18:22741994-22742016 CAATTACATCAGCTTGCTCCAGG - Intergenic
1155842283 18:30660370-30660392 CATTATCATCAGCTTCTCCAAGG + Intergenic
1158192978 18:54851756-54851778 CAATTTCATCAGAATCTCCAAGG + Intronic
1158686030 18:59615451-59615473 CAATGTCATCTGCCTTTTCCTGG + Intronic
1159613442 18:70551757-70551779 CATTTTCCTCTGCTTTCCCCTGG + Intergenic
1159874356 18:73793715-73793737 CCATGAAATCAGCTTTTCCCAGG + Intergenic
1159897470 18:74011180-74011202 CAATTAGGTCATCTTTTCCCAGG + Intergenic
1164457139 19:28418109-28418131 CATTTTCCTCTGCTTTTCTCAGG + Intergenic
1168281268 19:55306628-55306650 CACTCTCATCAGCATTTCCCTGG + Intronic
926384681 2:12324570-12324592 CTACAGCATCAGCTTTTCCCTGG - Intergenic
926860920 2:17307899-17307921 CTATGTCATCAGCATTGCCCAGG + Intergenic
929548460 2:42873553-42873575 CACACACATCAGCTTTTCCCGGG - Intergenic
930310960 2:49738877-49738899 CAATTTAATCTGATTTTCTCTGG + Intergenic
930719981 2:54629381-54629403 CAATGTCATCAGCATCTGCCTGG - Exonic
931840954 2:66147629-66147651 CATCTTCATTAGCTTTTCCCAGG + Intergenic
932128412 2:69166189-69166211 CAATTTGATCAGATTCTACCTGG + Intronic
932344453 2:70986495-70986517 CACTGTCATCAGCTTTCACCTGG - Exonic
932635965 2:73387826-73387848 AACTTTCATCATCTTTTGCCGGG - Intronic
933194413 2:79372083-79372105 CAATTACATCAGGTTCTCCGGGG + Intronic
933656252 2:84889262-84889284 CAGTTTCATCAGCGTTTCAGTGG + Intronic
933976161 2:87513109-87513131 CAACCTCATCAGTTTTTTCCTGG - Intergenic
934871487 2:97870674-97870696 CCATTTCTTCAGCTGTTTCCTGG - Intronic
935714444 2:105927595-105927617 CTATTTATTCAGCTTTTCCAAGG + Intergenic
936317661 2:111437692-111437714 CAACCTCATCAGTTTTTTCCTGG + Intergenic
936740748 2:115504403-115504425 GAATTTCATCATCTTTTGCTTGG + Intronic
937161748 2:119769464-119769486 GCATTTCAGCAGATTTTCCCAGG - Intronic
937286639 2:120758254-120758276 CAATCTCAGCAGCTTTTCTGAGG + Intronic
937422889 2:121773225-121773247 CGCTTTCTTCAGCTGTTCCCGGG + Intergenic
937432684 2:121852687-121852709 CTCTTTCTTCAGCTGTTCCCAGG + Intergenic
938771547 2:134505288-134505310 CAATTTTATCAGAATTTCCAGGG + Intronic
939404353 2:141736746-141736768 CATTTGCATCACCTTTTCTCAGG + Intronic
939454703 2:142418949-142418971 CCATTTCATCAACTTTCCTCTGG + Intergenic
941539748 2:166767394-166767416 CCATTTCCTCAGGTTTTTCCTGG + Intergenic
943037530 2:182765602-182765624 CAATTTCTTTAGCTGTCCCCAGG + Intronic
944425734 2:199581074-199581096 ATATTTCATCAGCTTTTCTCTGG - Intergenic
944591794 2:201224698-201224720 GAATTTCACCAGTATTTCCCAGG - Intronic
946075520 2:217070404-217070426 CACTTTGATCTCCTTTTCCCTGG + Intergenic
946617398 2:221524541-221524563 AAATTACAGCCGCTTTTCCCAGG - Intronic
946999883 2:225441832-225441854 CAAGTTCATTAGCTTTTCTAAGG + Intronic
947822439 2:233081584-233081606 GGATTTCATCAGCAGTTCCCAGG - Intronic
948343258 2:237272552-237272574 CAAAATCATCAGATTTTCCAAGG + Intergenic
948472101 2:238189438-238189460 AAATTTCAACGGCTTTTTCCAGG + Intronic
1171017248 20:21553138-21553160 CAGTTCCATGAGGTTTTCCCAGG - Intergenic
1173653544 20:44683150-44683172 CAATTTCATCAGCTCATGCAGGG + Intergenic
1175384310 20:58584548-58584570 CAATTTCAACTCCTTATCCCTGG + Intergenic
1175678030 20:60963897-60963919 AAATTCCTTCATCTTTTCCCTGG + Intergenic
1175880151 20:62253232-62253254 CAATTTCCTCACCTGTTACCTGG + Intronic
1179199264 21:39200536-39200558 AAATTTCATCAGCTTTTTTTGGG - Intronic
1179262151 21:39767239-39767261 CAATTTCTTCATCTTTAACCTGG + Intronic
1181150638 22:20880887-20880909 GGATTTCAACAGCTTCTCCCAGG - Intronic
1181829336 22:25546796-25546818 CCTTTTCATCACCTTCTCCCTGG - Intergenic
1181998702 22:26903201-26903223 AAATTGCATCAACTTTACCCAGG + Intergenic
1182517724 22:30868508-30868530 CAATTTCCTCATCTATTGCCTGG - Intronic
1184818076 22:46887231-46887253 CATTTTCATCTGAATTTCCCAGG - Intronic
1184828749 22:46970796-46970818 CAAGATCAGCAGGTTTTCCCTGG - Intronic
949728947 3:7084596-7084618 CCATTTCAGCAGCTCCTCCCAGG - Intronic
949867274 3:8556635-8556657 CAATTGCAACGGCTTTGCCCGGG - Intronic
950366162 3:12485595-12485617 CAATTACATCAGAATTTCCTGGG - Intronic
950443935 3:13025371-13025393 CAATGGCATCAGCATCTCCCAGG - Intronic
950893050 3:16422245-16422267 CAATTTCAACAGAGTTTACCAGG + Intronic
952222898 3:31342352-31342374 CAAATTCATCATTCTTTCCCTGG - Intergenic
952839615 3:37633858-37633880 TTATTTCAAAAGCTTTTCCCAGG - Intronic
952983432 3:38756730-38756752 CAATTTCATCAGTGGTTGCCTGG + Exonic
955012081 3:55027549-55027571 CAAATTTATCAGCCCTTCCCTGG + Intronic
955712006 3:61789973-61789995 CATTTTCAGCAGCTGTTTCCTGG + Intronic
956292276 3:67673326-67673348 CAATTTAACCAGCTTTTACTGGG - Intergenic
958033136 3:88138018-88138040 TAATTGCATCAGCTTTTACTTGG - Intronic
958654922 3:96988311-96988333 CAATTTCATACACCTTTCCCAGG - Intronic
958843173 3:99233218-99233240 CAATTTCTTGACCTTTTCTCTGG - Intergenic
958991785 3:100854482-100854504 CAATTTCATGAATTTTTCTCAGG - Intronic
960717193 3:120587508-120587530 CCCTATCATCATCTTTTCCCTGG - Intergenic
960901160 3:122555798-122555820 CAAATCCACCAGCTTTTACCAGG + Exonic
961044634 3:123700023-123700045 CAAGTTCATCATCCTCTCCCAGG - Exonic
962814306 3:138984671-138984693 CAATTTCAGCAGGCTTTCCTGGG + Intergenic
965260488 3:166477943-166477965 CATTTTCCTCTGCTTTTCTCAGG - Intergenic
967026994 3:185573413-185573435 CAATTTCTTTAGCTGTCCCCAGG - Intergenic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
969695548 4:8732203-8732225 CAGTTTCTTCAGCTTTTGCCTGG - Intergenic
970161397 4:13192981-13193003 CAACTTCCTCAGATTTCCCCAGG + Intergenic
971558920 4:28049533-28049555 GAACTTCCTCAGCTTTTACCTGG + Intergenic
971605153 4:28649831-28649853 CATATTCATCAGATTTTCCAAGG - Intergenic
972732901 4:41812694-41812716 CCATTTCATCATCTCTTACCTGG + Intergenic
972915163 4:43868162-43868184 CAAATACATCAAATTTTCCCTGG + Intergenic
973912366 4:55593853-55593875 TAATTTAATCAGCAGTTCCCAGG - Intergenic
974572346 4:63669301-63669323 CAAAATCATCAGATTTTCCAAGG - Intergenic
974589814 4:63930916-63930938 GAATTTCTTCAGCTTTTGCTTGG - Intergenic
975987969 4:80222032-80222054 TGTTTTCATCATCTTTTCCCTGG + Intergenic
977141506 4:93378452-93378474 CAAGTTAATCAGCTTCTCCCAGG + Intronic
978009647 4:103663934-103663956 TGATTACATCAGCTTTTCCAAGG + Intronic
978056403 4:104273662-104273684 CACTTTGATCAGCTTGCCCCAGG + Intergenic
978725102 4:111960346-111960368 CATTTTTGTCAGCTTGTCCCTGG + Intergenic
978965765 4:114739373-114739395 CAATTGCCTCAGCTTTTCTTGGG - Intergenic
979833037 4:125324483-125324505 TCATTTCCTCAGCTTTTCTCTGG - Intronic
981201279 4:141982488-141982510 TAATGTGAACAGCTTTTCCCAGG + Intergenic
981290008 4:143063601-143063623 CAATTGCATCAGATTATCCAAGG - Intergenic
982085198 4:151828402-151828424 CAATTTCATCTGATTCTCCTTGG + Intergenic
982096120 4:151925050-151925072 GAATTTAACCAGCTTTTCCTGGG - Intergenic
982192397 4:152870086-152870108 CATTTTCATAAGATTTCCCCAGG - Intronic
982323470 4:154105078-154105100 GAGTTTAATCAGTTTTTCCCAGG + Intergenic
983112277 4:163767253-163767275 CAAATTAATCAGATTTTCACAGG - Intronic
986351081 5:6879944-6879966 TAATTTCATCTGCCTTTGCCAGG + Intergenic
987022008 5:13884112-13884134 CAATAGCATCATCTTTTCCTCGG - Intronic
990694492 5:58400767-58400789 GAATTTCAACAGCTTTTCAGGGG - Intergenic
990895631 5:60697741-60697763 CAGTTTCACCAGAATTTCCCAGG - Intronic
991153615 5:63401767-63401789 TAATTTCATTTGCTTTTACCTGG - Intergenic
991280882 5:64911588-64911610 TAAATTCAGCAGATTTTCCCAGG - Intronic
994391647 5:99198359-99198381 CAATATCATCCTCTCTTCCCTGG + Intergenic
995030123 5:107471092-107471114 CCAATTCATCAGGCTTTCCCAGG + Intronic
995188817 5:109299032-109299054 CCATTTCCTTAGCTTTTTCCAGG + Intergenic
996325008 5:122262857-122262879 CTATTTCAGCAGCTCTTCACAGG + Intergenic
996630787 5:125629761-125629783 CAGTTTCAGCAGTTCTTCCCAGG + Intergenic
997687566 5:135799337-135799359 TAATATCATCTTCTTTTCCCTGG - Intergenic
1001057210 5:168459660-168459682 CTATTTCATCAGTCTGTCCCTGG + Intronic
1001057287 5:168460196-168460218 CATTTGCATCAACTCTTCCCTGG - Intronic
1001610221 5:172994581-172994603 TAATTACATAAACTTTTCCCAGG + Intronic
1001817408 5:174681587-174681609 CAGTTTCATCAGCAATTGCCTGG - Intergenic
1007683460 6:43650264-43650286 CCATTTCAACAGCTTTTCCTGGG + Intronic
1007719160 6:43875256-43875278 CAGTTTCACCATCTTTTACCTGG + Intergenic
1009555333 6:65156792-65156814 CATCTTCATCAGTCTTTCCCTGG + Intronic
1010407282 6:75519666-75519688 CAATTCCCACAGATTTTCCCTGG + Intergenic
1011109817 6:83824750-83824772 CAATTTCCTCACCTTTCCCCTGG - Intergenic
1013609478 6:111780772-111780794 CAGTTTCCTCTGTTTTTCCCAGG + Intronic
1014123981 6:117756493-117756515 AAATTCCATCAGCTTTTGTCTGG - Intergenic
1016622398 6:146127456-146127478 CAATATCACCTGCATTTCCCTGG - Intronic
1017845950 6:158258455-158258477 CCAACTCATCAGCTCTTCCCTGG - Intronic
1018124862 6:160672039-160672061 CATAATCATCAGCTTTTCCAAGG + Intergenic
1018679008 6:166247940-166247962 AAATCTCATCTGCTTTTCCTGGG + Intergenic
1020378019 7:7509741-7509763 TAATTTCATCTAGTTTTCCCAGG + Intronic
1021001727 7:15340200-15340222 CAATTTATTCAGCCTTTCCAAGG - Intronic
1021077798 7:16326573-16326595 CAACTTCATCACTTTTTTCCAGG - Intronic
1022196114 7:28068988-28069010 AAATTACATGAGATTTTCCCAGG - Intronic
1023161160 7:37297292-37297314 CCATTTCAGCAACTTTTCACAGG - Intronic
1023634599 7:42197183-42197205 AAGTTTAATCGGCTTTTCCCAGG + Intronic
1023670030 7:42566296-42566318 CAATTTCATTAACTTTCCTCAGG + Intergenic
1027568356 7:79828405-79828427 CAATTTTATCAACTTTACTCAGG - Intergenic
1028199783 7:87948001-87948023 ACATTACATCAGGTTTTCCCTGG + Intronic
1031421648 7:121559343-121559365 AAATTTCAGAAGCTTTTCGCTGG - Intergenic
1032475519 7:132208975-132208997 AAATGTCCTCAGCATTTCCCAGG - Intronic
1032990642 7:137391127-137391149 GAATTCCATCAGCTTCTTCCAGG + Exonic
1033459219 7:141530204-141530226 CCATTGCATCCGCTTTGCCCTGG + Intergenic
1034313803 7:150111785-150111807 GGATTTCATGAGCTTTTCCCTGG - Intergenic
1034330749 7:150280186-150280208 CAATTACATCAGAATCTCCCAGG + Intronic
1034621834 7:152463047-152463069 CAATATAATCAGCTTTGCCTGGG - Intergenic
1034667295 7:152829663-152829685 CAATTACATCAGAATCTCCCAGG - Intronic
1034793095 7:153989007-153989029 GGATTTCATGAGCTTTTCCCTGG + Intronic
1035066426 7:156108502-156108524 CAATTTCATAAGCTTCTACTAGG + Intergenic
1035162634 7:156962227-156962249 CAGTTTCCTCAGCTTCTCCACGG - Exonic
1035710074 8:1706365-1706387 CACTTTCACCACCTGTTCCCAGG - Exonic
1035980879 8:4370391-4370413 CAATATCATCAGATTTTCCAAGG - Intronic
1036228255 8:6978547-6978569 CAACCTCATCAGCTCTTGCCTGG + Exonic
1036230708 8:6997664-6997686 CAACCTCATCAGCTCTTGCCTGG + Exonic
1036233154 8:7016763-7016785 CAACCTCATCAGCTCTTGCCTGG + Exonic
1036609233 8:10335142-10335164 CAATGTCATCAGCTTCTCCATGG + Intronic
1037415531 8:18645871-18645893 TAATTTTATCAGTTTTTCCATGG + Intronic
1038212508 8:25532631-25532653 CAATATCCTCAGCATTTCCTGGG - Intergenic
1038909632 8:31948499-31948521 CAATTTCAACAGCATTTGGCAGG - Intronic
1041043686 8:53871639-53871661 TAATTACAACAGCTTGTCCCTGG + Intronic
1041437194 8:57855249-57855271 TAAATCCATCAGCTTTTTCCAGG + Intergenic
1042522406 8:69727520-69727542 CATTTTCATCAACTCTTCACTGG + Intronic
1043294841 8:78649675-78649697 CAATTTCTTTAGCTGTCCCCAGG - Intergenic
1045560584 8:103258315-103258337 CCATGTAATGAGCTTTTCCCCGG + Intergenic
1046735698 8:117774578-117774600 CAAATTCATCAGATTTTCCAAGG + Intergenic
1047399929 8:124537804-124537826 CAATTTCAAAACCTTTTTCCTGG + Intronic
1048938759 8:139378461-139378483 CAATTTCAACAGATTTTCAAAGG - Intergenic
1051061324 9:13048110-13048132 CAATTTCATAGCCTATTCCCTGG - Intergenic
1051254037 9:15193372-15193394 CAATTTAATAAGCAATTCCCAGG - Intronic
1053073778 9:35116077-35116099 CAGGATCCTCAGCTTTTCCCAGG + Intronic
1054728210 9:68674192-68674214 CAATTCCATCTTCTTTCCCCTGG + Intergenic
1054849181 9:69828902-69828924 CACTTTCTACAGCTTTTCCCTGG + Intronic
1055318277 9:75055882-75055904 CCATTTCATCAGGTTATCCATGG - Intergenic
1055593633 9:77843766-77843788 CAATTTAAACAGCTGTTCCTGGG + Intronic
1055889070 9:81103561-81103583 GAAATTCATCAGCCTTCCCCAGG + Intergenic
1056027324 9:82512567-82512589 AAGTTTCATCAGTATTTCCCAGG - Intergenic
1056224429 9:84481374-84481396 TAATTTAATTAGCTTTTCCGCGG + Intergenic
1057520607 9:95757135-95757157 CATTTTTTTCAGCTTTCCCCAGG + Intergenic
1057664208 9:97031375-97031397 AAATTTCACCAGCTCATCCCCGG + Exonic
1058999931 9:110337804-110337826 GATTTTCATCAGCACTTCCCTGG - Exonic
1059561610 9:115340271-115340293 CAATTTTATCTGCATATCCCTGG - Intronic
1059658343 9:116377074-116377096 CACTTTCATCAGCATTGCCGTGG - Intronic
1059806635 9:117808191-117808213 CAAATTTATCAGCTTCTCACTGG + Intergenic
1188588187 X:31802464-31802486 CAATCTCATCATCTCTTTCCTGG - Intronic
1188756862 X:33973409-33973431 CATTTTCATCAGATTCTCCAAGG - Intergenic
1189172134 X:38919071-38919093 CAATTTCATCAGTCTTTCCATGG + Intergenic
1190527003 X:51338451-51338473 AACTTTCATCAAGTTTTCCCTGG + Intergenic
1192507886 X:71700889-71700911 CAATTTCTTTAGCTGTCCCCAGG - Intergenic
1192518810 X:71780663-71780685 CAATTTCTTTAGCTGTCCCCAGG + Intergenic
1193347199 X:80417759-80417781 CAAAGTCATCAGATTTTCCAAGG - Intronic
1193519876 X:82516154-82516176 AAATTTCATTAGCTGTTACCAGG + Intergenic
1194966737 X:100296898-100296920 CAATTTCATCAGCTTTTCCCAGG + Intronic
1198563251 X:137875572-137875594 CAATTTCATCAGTCTTTTCAAGG - Intergenic