ID: 1194969060

View in Genome Browser
Species Human (GRCh38)
Location X:100322618-100322640
Sequence TCTAATCCTGCAAAGAATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1276
Summary {0: 1, 1: 3, 2: 24, 3: 356, 4: 892}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194969060 Original CRISPR TCTAATCCTGCAAAGAATGA TGG Intronic
900008275 1:79934-79956 TCTAGTTCTGTGAAGAATGATGG - Intergenic
900375759 1:2353880-2353902 TCAACTCCTGCATGGAATGAAGG + Intronic
900674846 1:3878755-3878777 TTTAATCCTGCACAAAATGCTGG + Intronic
901723672 1:11221977-11221999 ACTGATACTCCAAAGAATGAGGG + Intronic
903582670 1:24383833-24383855 TATAATTATGCAATGAATGAAGG + Intronic
904569519 1:31452028-31452050 TCTAGTTCTGTGAAGAATGATGG + Intergenic
904849902 1:33450336-33450358 TCTAATTCTGTGAAGAATGATGG - Intergenic
905572942 1:39020562-39020584 TCTAATTCTGTGAAGAATGGTGG + Intergenic
906053585 1:42895790-42895812 TATAATTCTGTGAAGAATGATGG + Intergenic
906360557 1:45154217-45154239 TCTAGTTTTGTAAAGAATGATGG - Intronic
906563625 1:46779456-46779478 TCTAACTCTGTGAAGAATGATGG + Intronic
906876753 1:49547526-49547548 TCTAATTCTGTAAAGAATGATGG + Intronic
907349574 1:53816067-53816089 TCTAATTCTGTGAAGAATGATGG - Intronic
907824999 1:58007301-58007323 TCTAATCCTTCTGAGGATGAGGG - Intronic
908614114 1:65898434-65898456 TCCAATGCTGTGAAGAATGATGG - Intronic
908819950 1:68075568-68075590 TCTAGTCCTGTGATGAATGATGG + Intergenic
908890432 1:68840953-68840975 TCTAGTTCTGTAAAGAATGATGG + Intergenic
908982162 1:69971740-69971762 TCTAATTCTGTGAAGAATGATGG - Intronic
909126935 1:71684343-71684365 CGTAATCTTGCAAAGGATGAGGG + Intronic
909639416 1:77855413-77855435 TCTAATTCTGTGAAGAATGATGG + Intronic
909667173 1:78147859-78147881 TCTAATTCTGTGAAAAATGATGG + Intergenic
909674060 1:78219499-78219521 TCTAATTTTGTGAAGAATGATGG - Intergenic
909806624 1:79880752-79880774 TCTAATTCTGGAAAGAATGTGGG - Intergenic
909947985 1:81685157-81685179 TCTAATTCTGTGAAGAATGATGG + Intronic
910078029 1:83303493-83303515 TCTAACTCTGTGAAGAATGATGG - Intergenic
910106427 1:83636026-83636048 TCTAAACATGAAAAAAATGAAGG + Intergenic
910380806 1:86624643-86624665 TCTAGTCCTGTGAAAAATGATGG - Intergenic
910543959 1:88393223-88393245 TCTAATTTTGTGAAGAATGATGG - Intergenic
910738604 1:90490532-90490554 TCTATTTCTGTGAAGAATGATGG + Intergenic
911081082 1:93931841-93931863 TCTAATTCTGTGAAGAATGATGG - Intergenic
911689511 1:100816638-100816660 TCTAATTCTGTGAAGGATGATGG - Intergenic
911847278 1:102770242-102770264 TTTAATTCTGTGAAGAATGATGG + Intergenic
912081352 1:105941044-105941066 TCTAATTCTGTGAAGAATGATGG + Intergenic
912180671 1:107215660-107215682 TCTAGTTCTGTGAAGAATGATGG + Intronic
912422601 1:109555151-109555173 TCTAGTTCTGTGAAGAATGATGG - Intronic
912606235 1:110992347-110992369 TCTAACTCTGTGAAGAATGATGG + Intergenic
913038710 1:115002013-115002035 TCTAGTTCTGTGAAGAATGATGG - Intergenic
913143541 1:115966263-115966285 TCTAATTTTGTGAAGAATGATGG - Intergenic
913151731 1:116051182-116051204 TCTAATTCTGTGAGGAATGATGG - Intronic
913236598 1:116789829-116789851 TCTAGTTCTGCAAAGAATGATGG - Intergenic
913338097 1:117729072-117729094 TCTAGTTCTGTGAAGAATGATGG - Intergenic
913339376 1:117742852-117742874 TCTAGTTCTGTGAAGAATGATGG + Intergenic
913587688 1:120292062-120292084 TCTAATTCTGTAAAGAATGATGG + Intergenic
913620497 1:120606307-120606329 TCTAATTCTGTAAAGAATGATGG - Intergenic
913972668 1:143426146-143426168 TGTAATTCTGTGAAGAATGATGG + Intergenic
914067052 1:144251759-144251781 TGTAATTCTGTGAAGAATGATGG + Intergenic
914112101 1:144714595-144714617 TGTAATTCTGTGAAGAATGATGG - Intergenic
914346453 1:146803636-146803658 CCTAATTCTGTGAAGAATGATGG - Intergenic
914455005 1:147828013-147828035 TCTAATTCTGAAAAGAATGATGG + Intergenic
914569708 1:148903931-148903953 TCTAATTCTGTAAAGAATGATGG + Intronic
914603121 1:149226327-149226349 TCTAATTCTGTAAAGAATGATGG - Intergenic
914733774 1:150396664-150396686 TCTAATTCTGTAAAGGATGATGG - Intronic
915829113 1:159109011-159109033 TCTAATTCTGTGAAGAATGGTGG - Intronic
916006030 1:160661289-160661311 TCTAATTCTGTGAAAAATGATGG + Intergenic
916263920 1:162870468-162870490 TCTAATTCTGTGAAGAATGATGG - Intergenic
916277731 1:163013303-163013325 TCTATTTCTGTGAAGAATGATGG + Intergenic
916872787 1:168935355-168935377 TCTAGTTCTGTGAAGAATGATGG + Intergenic
917317159 1:173737734-173737756 TCTAGTTCTGTGAAGAATGATGG + Intronic
917319378 1:173763354-173763376 TCTAATTCTGTGAAGAATGATGG - Intronic
917986910 1:180329899-180329921 TCTAATCCTCCACAAAATAATGG + Intronic
918721406 1:187856974-187856996 TCTAATTCTGTGAAGAATGATGG + Intergenic
918819405 1:189232940-189232962 TCTAGTTCTGTGAAGAATGATGG + Intergenic
918850863 1:189688056-189688078 TCTAGTTCTTTAAAGAATGATGG + Intergenic
918937803 1:190946463-190946485 TTTATTCCTGCAAAGTATTATGG - Intergenic
919073061 1:192780179-192780201 TCTAATTCTGTGAATAATGATGG + Intergenic
919190252 1:194207663-194207685 TCTAATTCTGTGAAGAATGATGG - Intergenic
919283556 1:195522911-195522933 TCTAATTCTGTGAAAAATGATGG - Intergenic
920990186 1:210930150-210930172 TCTAGTTCTGTGAAGAATGATGG - Intronic
921028662 1:211316403-211316425 TCTATTCCTAAAAAGAATGTAGG - Intergenic
921409582 1:214821194-214821216 TCTAATTTTGTGAAGAATGATGG + Intergenic
921834891 1:219768345-219768367 TCTAATTCTGTAAGGAATGATGG - Intronic
922372276 1:224923493-224923515 TATAATGCTGCAAAGAAGGTAGG - Intronic
922658311 1:227405694-227405716 TCTAATTCTATGAAGAATGATGG - Intergenic
922672992 1:227528000-227528022 TGTAATTCTGTGAAGAATGATGG + Intergenic
922995567 1:229956172-229956194 TCTAATTCTGTGAAGAATGATGG + Intergenic
923662074 1:235966706-235966728 TCTAATTCTGTGAAGAATGACGG - Intergenic
923909765 1:238428236-238428258 TCTAATTCTGTGAAAAATGATGG + Intergenic
923960758 1:239080722-239080744 TCTAGTTCTGTGAAGAATGATGG + Intergenic
923996690 1:239503528-239503550 TCTAATTCTGTGAAGAATGATGG - Intronic
924031704 1:239891802-239891824 TCTTATCAGGCAAAGAAGGAGGG + Intronic
924550863 1:245075558-245075580 TCTCCTCCTGCAAAGAATTAAGG - Intronic
924930482 1:248727476-248727498 TCTAGTTCTGTGAAGAATGATGG - Intronic
924935784 1:248768597-248768619 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1062761197 10:21630-21652 TGTAATTCTGTGAAGAATGATGG - Intergenic
1063537181 10:6894737-6894759 TCTAAACTTGCAAAGAAAGCTGG + Intergenic
1063544572 10:6967996-6968018 TCTACTTCTGTGAAGAATGATGG - Intergenic
1064858679 10:19800254-19800276 TGAAATCCTGCAAAAGATGAAGG - Intergenic
1064907752 10:20366008-20366030 TCTAATTCTGTGAAGAATGATGG + Intergenic
1065470583 10:26077018-26077040 CCTAATTCTGTGAAGAATGATGG + Intronic
1066560339 10:36663075-36663097 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1067233758 10:44429856-44429878 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1067303776 10:45039053-45039075 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1067554296 10:47257411-47257433 ACTCATACTGCAAAGAATCAGGG + Intergenic
1068077559 10:52275702-52275724 TCTAATTCTGTGAAGAATGATGG + Intronic
1068096399 10:52497384-52497406 TATAATTCTGTGAAGAATGATGG + Intergenic
1068099230 10:52531283-52531305 TCTAGTCCTGTGAAGAATGATGG - Intergenic
1068341691 10:55712458-55712480 GGTAATCCTGCAAAGATTCAGGG - Intergenic
1068481134 10:57589897-57589919 TCTAATTCTGTGAAGAATTATGG - Intergenic
1068670899 10:59722542-59722564 TCTAGTTCTGTGAAGAATGATGG + Intronic
1068809137 10:61236090-61236112 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1068924574 10:62522207-62522229 TCTAGTTCTGTGAAGAATGATGG + Intronic
1069129126 10:64677064-64677086 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1069218235 10:65849945-65849967 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1069228914 10:65981466-65981488 TCTAACTCTGTAAACAATGATGG - Intronic
1069242345 10:66158670-66158692 TCTAATTCTGTGAAGAATGATGG + Intronic
1069325769 10:67229940-67229962 TCTAATCCTGTGAAGAATGATGG - Intronic
1069343085 10:67435942-67435964 TCTAACTCTGTGAAGAATGATGG - Intronic
1069487636 10:68834612-68834634 TCTAATCCTGCTAGGAATGTGGG - Intronic
1070433646 10:76366263-76366285 TCTAATTCTGTGAAGAATGATGG + Intronic
1070465258 10:76715899-76715921 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1071015472 10:80992224-80992246 TCTAATTCTGTGAAGAATGATGG + Intergenic
1071023823 10:81088732-81088754 TCTAATTCTGTGAAGAATAATGG + Intergenic
1071045625 10:81372563-81372585 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1071170020 10:82853314-82853336 TCTAGTTCTGTGAAGAATGATGG + Intronic
1071485048 10:86094809-86094831 TCTAATTCTGTGAAGAACGATGG - Intronic
1071732750 10:88265375-88265397 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1071843832 10:89501273-89501295 TCTAATTCTGTGAAGAATAATGG - Intronic
1071910996 10:90233440-90233462 TCTAATTCTGTGAAGAATGATGG - Intergenic
1072164245 10:92797201-92797223 TCTAATTCTGTGAAGAACGATGG - Intergenic
1072392804 10:95005757-95005779 TCTAATTATGTGAAGAATGATGG + Intergenic
1072768861 10:98119457-98119479 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1072868471 10:99089696-99089718 TCTAGTTCTGTGAAGAATGATGG + Intronic
1072885701 10:99271614-99271636 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1073693227 10:105834910-105834932 ACTAAACCTGAAAAGAATGTTGG - Intergenic
1073810276 10:107144856-107144878 TATAATCCTGTAAAAAATGCAGG - Intronic
1073974366 10:109084648-109084670 CCCAGTTCTGCAAAGAATGATGG + Intergenic
1074984497 10:118645007-118645029 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1074985426 10:118654548-118654570 TCTAACTCTGTGAAGAATGATGG + Intergenic
1075449312 10:122538094-122538116 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1075613115 10:123869416-123869438 TCTAATCCTGAGAAGCATGTGGG + Intronic
1075660234 10:124189111-124189133 TCTAATTCTGTAAAGAATGATGG + Intergenic
1075889308 10:125932223-125932245 TCTAATTCTGTGAAGAATAATGG + Intronic
1075947172 10:126444640-126444662 TCTAATTCTGTGAAGAATGATGG - Intronic
1076665163 10:132084057-132084079 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1077833874 11:5906114-5906136 TCTAGTTCTGTGAAGAATGATGG + Intronic
1078588338 11:12614762-12614784 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1078683676 11:13506136-13506158 TATCATACTGCAAAGAATAAAGG + Intergenic
1078707012 11:13753989-13754011 TCTAATTCTGTGAAGAATGATGG - Intergenic
1079273295 11:19009085-19009107 TCTAATTCTGTGAGGAATGATGG + Intergenic
1079791288 11:24743211-24743233 TCTAATTCTGAGAAGAATGATGG + Intronic
1079856038 11:25606438-25606460 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1080152664 11:29072209-29072231 TCTAATTCTGTGAAGAATAATGG + Intergenic
1080324497 11:31054458-31054480 TCTAATTCTGTGAAGAATGATGG - Intronic
1080585516 11:33678361-33678383 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1080672154 11:34390539-34390561 TCTAATTCTGTGAAGAATGATGG + Intergenic
1080716199 11:34802811-34802833 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1080807527 11:35668092-35668114 TCTATTCCTGGAGAGAGTGAAGG + Intronic
1081009407 11:37789904-37789926 TCTAATTCTGTGAAGAATGATGG + Intergenic
1081106083 11:39071588-39071610 TCTAGTACTGTGAAGAATGATGG - Intergenic
1081326328 11:41749715-41749737 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1081539609 11:44022138-44022160 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1082104296 11:48203795-48203817 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1082917064 11:58448552-58448574 TCTAATTCTGTGAAGAATGATGG - Intergenic
1083017054 11:59465197-59465219 TCTAATTTTGTGAAGAATGATGG - Intergenic
1083064202 11:59906846-59906868 TCTAGTTCTGTGAAGAATGAAGG + Intergenic
1083528254 11:63393009-63393031 TCTAATTCTGTGAAAAATGATGG + Intronic
1085323204 11:75587483-75587505 TCTGAGCCTGTAAAGAATCAAGG - Exonic
1085748287 11:79134465-79134487 TCTAGTTCTGTGAAGAATGATGG - Intronic
1085893049 11:80603768-80603790 TGTAATCCTGCTGATAATGATGG + Intergenic
1086082428 11:82918600-82918622 TCTAATTCTGTGAAGAATGATGG + Intronic
1086511958 11:87568368-87568390 TCTAATTTTGTGAAGAATGATGG - Intergenic
1086824907 11:91484718-91484740 TCTAATTCTGTGAAGAATGATGG + Intergenic
1086986340 11:93253889-93253911 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1087070950 11:94079914-94079936 TCTAATTCTGTGAAGAATGGAGG - Intronic
1087321837 11:96670925-96670947 TCTAACTCTGTGAAGAATGATGG - Intergenic
1087405677 11:97727044-97727066 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1087429520 11:98034807-98034829 TCTAATGCTGTGAAGAATGATGG - Intergenic
1087469215 11:98550145-98550167 TCTAATTCTGTGAAGAATGATGG - Intergenic
1087602402 11:100333387-100333409 TCTAATTCAGTGAAGAATGATGG - Intronic
1087631784 11:100658662-100658684 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1087688578 11:101293328-101293350 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1087865850 11:103225773-103225795 TCTACTTCTGTGAAGAATGATGG + Intronic
1087942667 11:104117852-104117874 TCTACTTCTGTGAAGAATGATGG - Intronic
1088179878 11:107097240-107097262 TCTAATTCTGTGAAGAATGGTGG - Intergenic
1088206809 11:107401701-107401723 TCTAATTCTGTGAAGAGTGATGG - Intronic
1088240060 11:107764543-107764565 TCTAATTCTGTGAAGAATGATGG - Intergenic
1088414178 11:109570676-109570698 TCTAACTCTGTGAAGAATGATGG - Intergenic
1088824966 11:113485681-113485703 TCTAATTCTGTGAAAAATGATGG - Intergenic
1088951515 11:114575819-114575841 TCTAGTTCTGTGAAGAATGATGG - Intronic
1089825863 11:121276613-121276635 TCTAACTCTGTGAAGAATGATGG + Intergenic
1089937405 11:122378177-122378199 TCTAATTCTGTGAAGAATGATGG - Intergenic
1089960255 11:122610831-122610853 TCTAATCCTACCAGCAATGAAGG - Intergenic
1090142626 11:124280878-124280900 TCTAATTCTGTAAAGAATGATGG - Intergenic
1090221228 11:125028283-125028305 TCTATTTCTGTGAAGAATGATGG + Intronic
1090640409 11:128724906-128724928 ATTAAGCCTGCAGAGAATGATGG + Intronic
1090757678 11:129807914-129807936 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1090894632 11:130960158-130960180 TCTAATTCTGTGAAGAATGATGG + Intergenic
1090927734 11:131263828-131263850 TCTTATTCTGTGAAGAATGATGG - Intergenic
1092700351 12:11222155-11222177 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1092983543 12:13821803-13821825 TCTGGTCCTGGATAGAATGATGG - Intronic
1093278224 12:17155503-17155525 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1093597939 12:20984102-20984124 TCTAATTCTTTGAAGAATGATGG + Intergenic
1093690996 12:22108634-22108656 TCTAGTTCTGTGAAGAATGATGG - Intronic
1093720958 12:22441574-22441596 TCTAACTCTGTGAAGAATGATGG - Intergenic
1093777714 12:23097011-23097033 TCTGATTCTGCAAACACTGAGGG - Intergenic
1094091853 12:26659279-26659301 TATATTCCTGCAAAGAAGAAAGG + Exonic
1094157976 12:27357484-27357506 TCTAGTTCTGTGAAGAATGATGG - Intronic
1094262650 12:28519069-28519091 TCTAATTCTGTGAAGAATGTTGG + Intronic
1094591888 12:31829499-31829521 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1094726498 12:33123509-33123531 TCTCATAATGCAAAGAATAAAGG - Intergenic
1094778693 12:33763959-33763981 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1094802416 12:34052094-34052116 TCTAACTCTGTGAAGAATGATGG - Intergenic
1094816997 12:34197629-34197651 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1095115576 12:38348026-38348048 TCTAACTCTGTGAAGAATGATGG - Intergenic
1095176667 12:39100378-39100400 TCTAATTCTGTGAAGAATGATGG - Intergenic
1095178532 12:39120877-39120899 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1095229074 12:39715545-39715567 TCTAGTTCTGTGAAGAATGATGG - Intronic
1095247700 12:39942232-39942254 TCTAATTCTGTGAAGAATGATGG + Intronic
1095252636 12:39997004-39997026 TCTAACTCTGTGAAGAATGATGG - Intronic
1095395705 12:41759943-41759965 TCTAATTCTGTGAAGAATGTCGG - Intergenic
1095500674 12:42834958-42834980 TCTAGTTCTTTAAAGAATGATGG + Intergenic
1095560464 12:43558772-43558794 TCTAATTCTGTGAAGAATGATGG + Intergenic
1095763048 12:45862342-45862364 AATAATCCTTCAATGAATGAAGG - Intronic
1095807913 12:46341143-46341165 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1095893348 12:47255640-47255662 TCTAATTCTGTGAAAAATGATGG - Intergenic
1095932456 12:47641334-47641356 TCTAATTCTGTGAAGAATGATGG - Intergenic
1096888225 12:54739503-54739525 TCTAATTCTGTGAAGAATGATGG + Intergenic
1096961885 12:55587682-55587704 TCTAATTCTGTGAAGAATGATGG - Intergenic
1097200581 12:57274936-57274958 TGTAATTCTGCGAAGAATGATGG - Intronic
1097295888 12:57962390-57962412 CCTAATTCTGTGAAGAATGATGG - Intergenic
1097465981 12:59925072-59925094 TCTAATTCTGTGAAGAATGATGG + Intergenic
1097504087 12:60442476-60442498 TCTAATTCTGTGAAGACTGATGG - Intergenic
1097547355 12:61021206-61021228 TCTAATTCTGTGAAGAATGATGG + Intergenic
1097638912 12:62155414-62155436 TCCAATTCTGTGAAGAATGATGG - Intronic
1098542803 12:71677138-71677160 TTTACTTCTGAAAAGAATGAAGG - Exonic
1098952653 12:76657785-76657807 ACTAATTCTGTGAAGAATGATGG - Intergenic
1098960379 12:76733788-76733810 TGTAATTCTGTGAAGAATGATGG + Intergenic
1098982300 12:76970066-76970088 TCTAATTCTGTGAAGAATGATGG + Intergenic
1099248645 12:80224437-80224459 TCTAGTTCTGTGAAGAATGATGG + Intronic
1099392043 12:82093647-82093669 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1099393110 12:82103673-82103695 TCTATTTCTGTGAAGAATGATGG - Intergenic
1099426966 12:82535357-82535379 TTTATTCCTGAAAAGAAGGAGGG - Intergenic
1099472636 12:83070208-83070230 TCTAATTCTGTGAAGAAGGATGG + Intronic
1099687252 12:85906392-85906414 TCTCATTCTGTGAAGAATGATGG + Intergenic
1099942488 12:89205028-89205050 TCTAAGGCTGCAAAGTATTATGG + Intergenic
1100126592 12:91434449-91434471 TTTAACACTGCAAAGAATAAAGG + Intergenic
1100290607 12:93210731-93210753 TCTAATTCTGTGAACAATGATGG + Intergenic
1100696869 12:97103791-97103813 TCTAATTCTGTGAAGAATGATGG + Intergenic
1100918895 12:99459875-99459897 TCTAGTTCTGTGAAGAATGATGG - Intronic
1100970800 12:100067968-100067990 TCTAGTTCTGTGAAGAATGATGG - Intronic
1100989558 12:100237524-100237546 TCTAGTTCTGTAAAGAATGATGG + Intronic
1101024709 12:100589542-100589564 TCTAATTCTGTGAAGAATGATGG - Intronic
1101298141 12:103447912-103447934 TCTAGTTCTGTGAAGAATGATGG - Intronic
1101836459 12:108299060-108299082 TCTAGTCCTGCACAGCATGCGGG - Intronic
1102435016 12:112915641-112915663 TCTAGTTCTGTGAAGAATGATGG + Intronic
1102916363 12:116756087-116756109 TCTAATTCTGTGAAGAATGATGG + Intronic
1103760387 12:123245402-123245424 TCTAATTCCGTGAAGAATGATGG + Intronic
1104181114 12:126382000-126382022 TCTAGTTCTGCAACGAATGATGG - Intergenic
1104332928 12:127864473-127864495 TCTAATTCTTTGAAGAATGATGG - Intergenic
1104343653 12:127976274-127976296 TCTAGTTCTGTGAAGAATGAGGG - Intergenic
1104479165 12:129092365-129092387 TCTACTTCTGCAAAGTTTGAGGG - Intronic
1104504119 12:129314642-129314664 TCTAATTCTGTGAAGAATGCTGG + Intronic
1105686177 13:22784506-22784528 ACTAATGCTGCAATAAATGATGG - Intergenic
1105908665 13:24839353-24839375 TCTAATTCTCTGAAGAATGATGG - Intronic
1105931178 13:25053978-25054000 TCTAATTCTATGAAGAATGATGG - Intergenic
1105990021 13:25610637-25610659 TCTAGTCCTGTAAGGAATGATGG + Intronic
1106294985 13:28404444-28404466 TCTCATCTGCCAAAGAATGATGG + Intronic
1106335710 13:28781077-28781099 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1106362214 13:29041465-29041487 TCTAGTTCTGTGAAGAATGATGG + Intronic
1106391879 13:29342173-29342195 TCTAGTTCTGTGAAGAATGATGG + Intronic
1106691588 13:32123159-32123181 CCTAATTCTGTGAAGAATGACGG - Intronic
1106921142 13:34564575-34564597 TCTAATTCTGTGAAGAATGATGG - Intergenic
1106937788 13:34743174-34743196 TCTAACTCTGTGAAGAATGATGG + Intergenic
1107167012 13:37294301-37294323 TCTTATCATGCAAAGAATAAGGG - Intergenic
1107665534 13:42685739-42685761 TCTTATTCTGCAAAAAAGGAAGG - Intergenic
1107666050 13:42692020-42692042 TCTAATTCTGTGAAGAATGATGG + Intergenic
1107755607 13:43618758-43618780 TCTAATTCTGTGAAGAATGATGG + Intronic
1107960959 13:45557955-45557977 TCTAGTTCTGTGAAGAATGATGG + Intronic
1108134778 13:47343972-47343994 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1108288628 13:48934572-48934594 TCTAATTCTGTGAAGAATTATGG + Intergenic
1108469092 13:50750457-50750479 TCTAATTCGGTGAAGAATGATGG + Intronic
1108787668 13:53925369-53925391 TCTAGTTCTGTAAAGAATTATGG - Intergenic
1108825935 13:54412423-54412445 TCTAATTCTGTGAAGAATGATGG - Intergenic
1108832021 13:54491235-54491257 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1109002309 13:56821069-56821091 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1109150871 13:58845725-58845747 TCCAGTTCTGTAAAGAATGATGG - Intergenic
1109200674 13:59427323-59427345 TCTAATTCTATGAAGAATGATGG - Intergenic
1109213238 13:59559091-59559113 TCTAATTCTGTGAAGAATGATGG + Intergenic
1109508005 13:63332413-63332435 TCTAATTCTGTGAAGAATGATGG + Intergenic
1109717621 13:66236731-66236753 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1110177998 13:72580289-72580311 ACTAATCCTGCAAAAACTCAGGG + Intergenic
1110204831 13:72900221-72900243 TCTAACTCTGGGAAGAATGATGG - Intronic
1110336699 13:74340760-74340782 TCTAATTCTGTGAAAAATGATGG + Intergenic
1110445101 13:75571359-75571381 TCCAAGACTGGAAAGAATGAAGG - Intronic
1110730257 13:78872433-78872455 CCTAATCCTGGAAATAATGATGG - Intergenic
1110756112 13:79176309-79176331 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1110881908 13:80582222-80582244 TCTAATTCTGTGAAGAATGATGG - Intergenic
1111901434 13:94204289-94204311 CCTAATCCTCCAGAGAATCAGGG + Intronic
1111963603 13:94837976-94837998 TCTAATTCTGTGAAGAATAATGG - Intergenic
1112738503 13:102447953-102447975 TCTAATTTTGTGAAGAATGATGG - Intergenic
1112747688 13:102545639-102545661 TCTAATTCTGTGAAGAATGATGG - Intergenic
1112945695 13:104924283-104924305 TCTAACTCTGTGAAGAATGATGG - Intergenic
1113097788 13:106684206-106684228 TCTAAGCCTGCAGATAATGTTGG - Intergenic
1113637775 13:111932346-111932368 TCTAGTTCTGTAAAGAATGATGG + Intergenic
1113845163 13:113383727-113383749 TCTAATTCTTTGAAGAATGATGG + Intergenic
1114030408 14:18573663-18573685 TGTAATTCTGTGAAGAATGATGG + Intergenic
1114054096 14:18951476-18951498 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1114108459 14:19450456-19450478 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1114505087 14:23204745-23204767 TCTAATTCTATGAAGAATGATGG + Intronic
1114691790 14:24589603-24589625 TCTAATTTGGTAAAGAATGATGG + Intergenic
1114961577 14:27897319-27897341 TCCAACTCTGTAAAGAATGATGG + Intergenic
1115130119 14:30044849-30044871 TCTAATTCTATGAAGAATGATGG - Intronic
1115751575 14:36498674-36498696 TCAAAGCCTGGCAAGAATGAAGG - Intronic
1115835246 14:37395270-37395292 TCTAATTCTGTGAAGAATGATGG + Intronic
1115937752 14:38573792-38573814 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1115959050 14:38814190-38814212 TCGAATTCTGTGAAGAATGATGG - Intergenic
1115970240 14:38937296-38937318 TCTTATTCTGTGAAGAATGATGG - Intergenic
1116048669 14:39776990-39777012 TCTGATTCTGTGAAGAATGATGG + Intergenic
1116117605 14:40676645-40676667 TCTAATTCTGTGAAAAATGATGG - Intergenic
1116125364 14:40777300-40777322 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1116223699 14:42120314-42120336 TCTAATTCTCTGAAGAATGATGG - Intergenic
1116335873 14:43655745-43655767 TCTTATTCTGTGAAGAATGATGG - Intergenic
1116540020 14:46090431-46090453 GCTAATGCTGCAGAGAATCATGG + Intergenic
1116652459 14:47610827-47610849 TCTAATTCTGTGAAGAATTATGG - Intronic
1116732372 14:48640307-48640329 TCTAATTCTGTGAAGAACGATGG - Intergenic
1117103436 14:52374179-52374201 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1117113143 14:52479790-52479812 TCTAGTTCTGTGAAGAATGATGG - Intronic
1117122090 14:52579113-52579135 TCTAATCTTTCAAAGAGTAAAGG + Intronic
1117509740 14:56438601-56438623 TCTAATTCTGTGAAGAATGTTGG + Intergenic
1117697458 14:58380186-58380208 TCTAGTTCTGTAAAGAATGATGG + Intergenic
1117768905 14:59112305-59112327 TCTAATTCCGTGAAGAATGATGG - Intergenic
1118162679 14:63306315-63306337 TCTAATTCTGTGAAGAGTGATGG - Intergenic
1118421004 14:65603501-65603523 TCTAATTCTGTAAAGAATGATGG + Intronic
1118423738 14:65634853-65634875 TCTAATTCTGTGAAGAATGATGG + Intronic
1120223964 14:81769233-81769255 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1120288959 14:82542255-82542277 TCTAATTCTGTGAAGAATGATGG + Intergenic
1120356031 14:83435245-83435267 TCTAATTCTGTTAAGAATGATGG - Intergenic
1120505510 14:85350453-85350475 TCTAGACCTGGAAAGAATGATGG - Intergenic
1120735949 14:88052995-88053017 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1121130823 14:91445599-91445621 TCTATTTCTGCAGAGAATGTTGG - Intergenic
1121460252 14:94070478-94070500 TCTAATTCTGTGAAGAATGATGG - Intronic
1121575799 14:94985855-94985877 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1123177195 14:106431297-106431319 TTTAATTCTGTGAAGAATGATGG + Intergenic
1123184261 14:106499946-106499968 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1123213686 14:106785758-106785780 TCTAATTCTGTGAAGAATGATGG + Intergenic
1202900041 14_GL000194v1_random:29987-30009 TGTAATTCTGTGAAGAATGATGG + Intergenic
1123771802 15:23536695-23536717 TCTCTTCCTGCAAGGACTGAGGG - Intergenic
1124381096 15:29166789-29166811 TCTAATTCTGTGAAGAATGATGG - Intronic
1124387088 15:29218434-29218456 TCTAATCCTATGAAGAATGGTGG - Intronic
1124557504 15:30740477-30740499 TCTAATTCTGTGAAGAATGATGG - Intronic
1124673748 15:31665181-31665203 TCTAATTCTGTGAAGAATGATGG + Intronic
1124806762 15:32891548-32891570 TCTAATTCTGTTAAGAATGATGG + Intronic
1125273083 15:37961561-37961583 TCTATTTCTGTGAAGAATGATGG + Intronic
1125367830 15:38938221-38938243 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1125823460 15:42654897-42654919 TCTAGTTCTGTGAAGAATGATGG - Intronic
1126190939 15:45877936-45877958 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1126460409 15:48909070-48909092 TCTAATTCTGTGAAGAATGATGG + Intronic
1126488186 15:49206347-49206369 TCTAAGTCTGTGAAGAATGATGG + Intronic
1126577922 15:50215432-50215454 TCTAATTCTGTGAAGGATGATGG - Intronic
1126733896 15:51712492-51712514 TCTTATCCTGCAGGGAATGCAGG + Intronic
1126741327 15:51779359-51779381 TCTACTCATTAAAAGAATGAAGG - Intronic
1127194833 15:56572990-56573012 TCTAATTCTGTGAAGAATGATGG - Intergenic
1127361768 15:58250669-58250691 TCTAGTTCTGTGAAGAATGATGG + Intronic
1127628935 15:60807544-60807566 TCTAGTTCTGTGAAGAATGATGG - Intronic
1128696458 15:69767517-69767539 TCTATTTCTGCAAAAAATGTTGG + Intergenic
1129096527 15:73214800-73214822 TCTAATTTCGTAAAGAATGATGG + Intronic
1129555946 15:76509692-76509714 TCTAGTTCTGTGAAGAATGATGG - Intronic
1129928694 15:79389613-79389635 TCTAATTCTGTGAAGAATGATGG + Intronic
1130181740 15:81636712-81636734 TCTAATTCTGTGAAGAATGATGG + Intergenic
1130749400 15:86694117-86694139 TCTAGTTCTGTGAAGAATGATGG + Intronic
1130779930 15:87025618-87025640 TCTAATTGTGTGAAGAATGATGG - Intronic
1132033776 15:98462095-98462117 TCTAATTCTGCAAAGAATGGTGG - Intronic
1132412524 15:101594061-101594083 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1132445281 15:101912176-101912198 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1134333972 16:13277440-13277462 TCTAGTTCTGTAAAGAATGATGG + Intergenic
1134805746 16:17123098-17123120 TCTAGTTCTGTGAAGAATGATGG + Intronic
1134821522 16:17251204-17251226 TCCATTCCTGCAAAGGCTGATGG + Intronic
1135203218 16:20458273-20458295 TCTAGTTCTGTGAAGAATGATGG - Intronic
1135215885 16:20569595-20569617 TCTAGTTCTGTGAAGAATGATGG + Intronic
1136695255 16:32074509-32074531 TCTAATTCTGTGAAGAATGATGG - Intergenic
1136795754 16:33017766-33017788 TCTAATTTTGTGAAGAATGATGG - Intergenic
1136874164 16:33836614-33836636 TCTAATTCTGTGAAGAATGATGG + Intergenic
1138000862 16:53278227-53278249 TCTAGTTCTGTGAAGAATGATGG - Intronic
1138035058 16:53595950-53595972 TCTACTTCTGTGAAGAATGATGG + Intergenic
1138192479 16:55026408-55026430 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1139419183 16:66838879-66838901 TCCAATTCTGTGAAGAATGATGG - Intronic
1139987526 16:70911632-70911654 CCTAATTCTGTGAAGAATGATGG + Intronic
1140064356 16:71598049-71598071 TCTAATTCTGTGAAGAATGATGG - Intergenic
1140620061 16:76719013-76719035 TCTAATTCTGTGAAAAATGATGG - Intergenic
1141120509 16:81351596-81351618 TATAATCCTCCAAAAGATGATGG + Exonic
1203098012 16_KI270728v1_random:1279425-1279447 TCTAATTCTGTGAAGAATGATGG - Intergenic
1144139284 17:12332355-12332377 TCTAATTCTGTGAAGAATGATGG + Intergenic
1144510670 17:15872431-15872453 TCTAATTCTGTGAAAAATGATGG + Intergenic
1146583769 17:34063994-34064016 TCTAATTCTGTGAAGAATGATGG - Intronic
1146713195 17:35060756-35060778 TCTAATATTGCAAAGAATAACGG + Intronic
1146750957 17:35379681-35379703 TCTAATTCTGTGAATAATGATGG + Intergenic
1147730255 17:42595584-42595606 TAAAATCATACAAAGAATGAGGG + Intronic
1147752940 17:42748142-42748164 TGTAATCCTTCCATGAATGAGGG - Intergenic
1149022526 17:51985970-51985992 TCTAGTTCTGTAAAGAATGATGG - Intronic
1149124105 17:53207236-53207258 TCTAATTCTAAGAAGAATGATGG - Intergenic
1149149866 17:53548731-53548753 ACTAATGCTGCAATGAATGTGGG + Intergenic
1149410532 17:56401109-56401131 TCTAATTCTGTGAAGAATGATGG + Intronic
1149934883 17:60794925-60794947 TCTAATTCTGTGAAGAGTGATGG + Intronic
1150093025 17:62346453-62346475 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1150817731 17:68407380-68407402 TCTAATTCTGTGAAGAATGATGG + Intronic
1150945114 17:69737040-69737062 TCTAATTCTGTGAAAAATGATGG + Intergenic
1151048755 17:70952117-70952139 TCTAATTCTGTGAAGAATGATGG - Intergenic
1151079229 17:71309375-71309397 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1151281690 17:73080105-73080127 TCTAGTTCTGTGAAGAATGATGG - Intronic
1152501856 17:80717091-80717113 TCTAATTCTGTGAAGAATGATGG + Intronic
1152954104 18:21962-21984 TGTAATTCTGTGAAGAATGATGG - Intergenic
1153065830 18:1043986-1044008 TCCAATCCTGTGAAGAGTGATGG - Intergenic
1153069117 18:1085073-1085095 TCTAATTCTGTGAAGAATCATGG + Intergenic
1153168548 18:2289435-2289457 TCTAATTCCGTGAAGAATGATGG + Intergenic
1153175942 18:2373285-2373307 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1153220884 18:2860090-2860112 TCTAGTTCTGTGAAGAATGATGG + Intronic
1153861011 18:9206071-9206093 TCTAAACCTTGAAAGAATGTTGG + Intronic
1153921561 18:9794859-9794881 TCTAGTTCTGTGAAGAATGATGG - Intronic
1154298302 18:13170465-13170487 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1154487079 18:14880401-14880423 TGTAATTCTGTGAAGAATGACGG + Intergenic
1154498847 18:14984034-14984056 TGTAATTCTGTGAAGAATGACGG - Intergenic
1155060735 18:22226164-22226186 AATAATGCTGCAATGAATGAGGG - Intergenic
1155131589 18:22940164-22940186 TCTATTTCTGCAAAAAATGTTGG + Intronic
1155501720 18:26492960-26492982 CCAGATCCTCCAAAGAATGAAGG - Intronic
1156010896 18:32496584-32496606 TCTAATTCTGTGAAGAATGATGG + Intergenic
1156066661 18:33149858-33149880 TCTAGTTCTGTGAAGAATGATGG - Intronic
1156164198 18:34398346-34398368 TCTAGTTCTGCAAAGGATGATGG + Intergenic
1156425252 18:37004108-37004130 TCTAGTTCTGTGAAGAATGATGG + Intronic
1156597326 18:38562575-38562597 TCTAATACTGCAAATAGTTAAGG + Intergenic
1156667851 18:39429889-39429911 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1156939433 18:42747514-42747536 TCTAGTTCTGTGAAGAATGACGG - Intronic
1156984777 18:43337108-43337130 TCTAATTCTGTGAAGAATGATGG + Intergenic
1157219398 18:45815758-45815780 TCTAATTCTGTGAAGAATGATGG - Intergenic
1157541235 18:48509651-48509673 TCTAATTCTGTGAAGAATGATGG - Intergenic
1158002995 18:52640834-52640856 TCTAATTCTATGAAGAATGATGG - Intronic
1158056147 18:53283326-53283348 TCTATTCCAGGAAAGAAAGAAGG + Intronic
1158181568 18:54721623-54721645 TCTATTCCTTCACAAAATGATGG - Intronic
1158338498 18:56439409-56439431 TCTAATTCTATTAAGAATGATGG - Intergenic
1158756886 18:60336032-60336054 TCTAATTCTGTGAAGAATGATGG - Intergenic
1158830206 18:61268869-61268891 TCTAATTCTGTGAAGAATGATGG - Intergenic
1159612510 18:70541815-70541837 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1160180386 18:76629901-76629923 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1160224059 18:76998609-76998631 GCTATTCCTTCAAAGAATAAGGG - Intronic
1160267144 18:77348682-77348704 TCTAATTCTGTGAAGAATGATGG + Intergenic
1160279640 18:77475929-77475951 TCTAATTCTGTGAAGAATGATGG + Intergenic
1160640028 19:121531-121553 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1163952258 19:20600152-20600174 TCTAATTCTGTGAGGAATGATGG + Intronic
1164174879 19:22763598-22763620 TCTAATTCTGTGAAGAATGACGG - Intronic
1164238057 19:23355079-23355101 TCTAACTCTGTGAAGAATGACGG - Intronic
1164319708 19:24132647-24132669 TCTAACTCTGTGAAGAATGATGG + Intergenic
1166249258 19:41555816-41555838 TCTAAACTTGCAAAGAAACAAGG + Intronic
1166603865 19:44122519-44122541 TCTAATTCTATGAAGAATGATGG + Intronic
1166630766 19:44405335-44405357 TCTAGTTCTGGAAAGAATGATGG - Intergenic
1168395561 19:56044728-56044750 TTTAATTCTGTGAAGAATGATGG + Intronic
1202647445 1_KI270706v1_random:155684-155706 TGTAATTCTGTGAAGAATGATGG - Intergenic
925178554 2:1801399-1801421 CCTGTTCCTGCAAACAATGAAGG - Intronic
925246494 2:2388297-2388319 TCCAATCCTGCAGAAAGTGAAGG + Intergenic
925706426 2:6687935-6687957 TCTAGTTCTGTGAAGAATGATGG - Intergenic
925795345 2:7535518-7535540 TCTAGTACTGTGAAGAATGATGG + Intergenic
925951166 2:8912811-8912833 TCTAACTCTGTGAAGAATGATGG - Intronic
926527198 2:13995397-13995419 TCTAGTTCTGTAAAGAATGATGG - Intergenic
926915621 2:17888949-17888971 TCTAAGTCTGTGAAGAATGATGG + Intronic
927267633 2:21170530-21170552 TCTAGTTCTGTGAAGAATGATGG + Intergenic
927722462 2:25393864-25393886 TCTAGTCCTGTGAGGAATGATGG - Intronic
928110008 2:28499422-28499444 CATAATCCTGCCAATAATGACGG + Intronic
928417233 2:31105893-31105915 TCTAAACATGGAAAGAAGGAAGG - Intronic
928684972 2:33739901-33739923 TCTAGTTCTGTGAAGAATGATGG + Intergenic
928734096 2:34265607-34265629 TCTAATTTTGTGAAGAATGATGG - Intergenic
929009907 2:37430918-37430940 TCTAATTCTGTGAAGAATGATGG + Intergenic
929036952 2:37702738-37702760 TCTAATTCTGTGAAGAATGATGG + Intronic
929339689 2:40799920-40799942 TCTAATTCTGTGAAGAATGATGG + Intergenic
929722525 2:44385002-44385024 TCTAATTCGGTGAAGAATGATGG + Intronic
929806233 2:45147936-45147958 TCTAATTCTGTGAAGAATGATGG - Intergenic
930321432 2:49859071-49859093 TCTGATGCTTCAAAAAATGAGGG + Intergenic
930486141 2:52013649-52013671 TCTAACTCTGTGAAGAATGATGG + Intergenic
931524716 2:63140334-63140356 TCTAATTTTGTGAAGAATGATGG + Intronic
931902381 2:66804016-66804038 TCAAACACTGCAAAGAATGGAGG + Intergenic
931993250 2:67812176-67812198 TCTAATTCTGTGAAGAATGATGG - Intergenic
932062490 2:68520839-68520861 TCTAGTCCTGTGAAGAATGATGG + Intronic
932100178 2:68891829-68891851 TCTAATTCTGTGAAGAATTATGG + Intergenic
932270744 2:70407141-70407163 TCTAATTCTGTGAAGAATGATGG - Intergenic
932384499 2:71318924-71318946 TCTAATTCTGTGAAGAATGATGG + Intronic
932853281 2:75208651-75208673 TCTAGTTCTGTGAAGAATGATGG + Intergenic
932926067 2:75976364-75976386 TCTAGTTCTGTGAAGAATGATGG + Intergenic
933111122 2:78401547-78401569 TCTAGTTCTGTGAAGAATGATGG - Intergenic
933122438 2:78556933-78556955 TCTAGTTCTGTGAAGAATGATGG - Intergenic
933231754 2:79815781-79815803 TCTAATTCTGGGAAGAATGATGG + Intronic
933433118 2:82210564-82210586 TCTAGTTCTGTAAAGAATGATGG + Intergenic
933523252 2:83402488-83402510 TCTAGTTCTGTGAAGAATGATGG - Intergenic
934110998 2:88742568-88742590 TCTAGTTCTGTGAAGAATGATGG + Intronic
934177361 2:89587109-89587131 TGTAATTCTGTGAAGAATGATGG + Intergenic
934287660 2:91661422-91661444 TGTAATTCTGTGAAGAATGATGG + Intergenic
935104315 2:100025518-100025540 TCTAATTCTGTGAAGAATGATGG - Intronic
935467538 2:103416773-103416795 TCTAGTTCTGTGAAGAATGATGG - Intergenic
936164811 2:110111702-110111724 TCTAATTCTGTGAAGAATGATGG - Intronic
936614754 2:114037115-114037137 TCTAGTTCTGTGAAGAATGATGG + Intergenic
936772066 2:115925646-115925668 TCTAATTCTGTGAAGAATGATGG + Intergenic
936894817 2:117415295-117415317 TCTAGTTCTGTGAAGAATGATGG + Intergenic
936985886 2:118311017-118311039 TCAAATCCTGCAAGGATTGATGG + Intergenic
937058251 2:118958625-118958647 TCTAACTCTGTGAAGAATGATGG - Intronic
937529704 2:122813289-122813311 TCTAATTCTGTGAAGAATGATGG - Intergenic
937663378 2:124456537-124456559 TCTAATGCTGTGAAGAATGATGG - Intronic
937751784 2:125484250-125484272 TCTAGTCTTGTGAAGAATGATGG + Intergenic
937767255 2:125675966-125675988 TCTAATTCTGTGAAGAATGATGG + Intergenic
937971597 2:127553281-127553303 TCTAGTTCTGAGAAGAATGATGG + Intronic
938037635 2:128048786-128048808 TCTAACTCTGTGAAGAATGATGG + Intergenic
938216158 2:129518098-129518120 TCTAGTACTGTCAAGAATGATGG + Intergenic
938497808 2:131812121-131812143 TGTAATTCTGTGAAGAATGACGG - Intergenic
938597872 2:132807280-132807302 TCTAATTCTGTGAAGAATGATGG + Intronic
938797841 2:134733479-134733501 TCTAATTCTGCAAAGAATGATGG + Intergenic
939449614 2:142356428-142356450 TCTAATTCTGTGAAGAATGATGG - Intergenic
939813418 2:146864384-146864406 TCTAATTCTGTGAAGAATGATGG - Intergenic
940028236 2:149231579-149231601 TCTAATTCTGTGAAGAATGATGG - Intergenic
940056519 2:149518536-149518558 TCTAATTCTGTGAAGAATGATGG - Intergenic
940125911 2:150324138-150324160 TTTAATTCTGTGAAGAATGATGG + Intergenic
940157172 2:150669909-150669931 TCTAATTCTGTGAAGAATGATGG - Intergenic
940171999 2:150838908-150838930 TCTAATTCTGTGAAGAATGATGG + Intergenic
940707238 2:157120571-157120593 TCTAATTCCGTGAAGAATGATGG + Intergenic
940762780 2:157755783-157755805 TCTAGTTCTGTGAAGAATGACGG - Intronic
940784274 2:157965548-157965570 TCTAATTCTGTGAAGAACGATGG + Intronic
940796457 2:158085014-158085036 TCTAGTTCTGTGAAGAATGATGG + Intronic
940802630 2:158149876-158149898 TCTAATTCTGAGAAGAATGATGG - Intergenic
941382788 2:164816314-164816336 TCTAAGTCTGAAAAGAATGTGGG + Intronic
941431113 2:165415650-165415672 TCTAGTTCTGTGAAGAATGATGG + Intergenic
941631270 2:167887293-167887315 TCTAATTCTGTGAAGAATGATGG + Intergenic
941680014 2:168387707-168387729 TCTAATTCTGTGAAGAATGATGG - Intergenic
941702490 2:168618849-168618871 TCTAGTTCTGTTAAGAATGATGG - Intronic
941998523 2:171624224-171624246 TCTGATCGTGCAAAGAAACAAGG + Intergenic
942052357 2:172152096-172152118 TCTAGTTCTGTGAAGAATGATGG + Intergenic
942154355 2:173111935-173111957 TCTAATTCTGTGAAGAATGATGG + Intronic
942405736 2:175652523-175652545 TCTAGTTCTGTGAAGAATGATGG - Intergenic
942739420 2:179157337-179157359 TCTAATTCTGTGAAGAATGATGG - Intronic
943013311 2:182478821-182478843 TCTCATCATGCAAGAAATGAAGG + Intronic
943131322 2:183856671-183856693 TCTAATTCTGTGAAGAATGATGG - Intergenic
943654659 2:190495466-190495488 TCTAGTTCTGTGAAGAATGATGG - Intronic
943756691 2:191564576-191564598 TCTAATCCTCCAAAACAGGAGGG - Intergenic
943890924 2:193286077-193286099 TCTAATTCTGTGAGGAATGATGG + Intergenic
944421076 2:199530929-199530951 TCTAATGCTGTGAAGAATGATGG - Intergenic
944431658 2:199640179-199640201 TCTAATTTTGTGAAGAATGATGG + Intergenic
944438682 2:199719547-199719569 TCTAATTCTGTGAAAAATGATGG + Intergenic
944604715 2:201342299-201342321 TAAAATCCTGCAAAGGATGCGGG + Intronic
944632554 2:201642534-201642556 TCTAATCCTCAAAAGTAGGACGG + Intronic
944771969 2:202923593-202923615 TCTAATTCTGTGAAGAATGATGG - Intronic
944798404 2:203210942-203210964 TCTTATCCTGAAAAGAATTAAGG - Exonic
945034164 2:205689958-205689980 TCTAATCCAGAAAAAAAGGAGGG + Intronic
945131635 2:206579750-206579772 GCTAATTCTGTGAAGAATGATGG + Intronic
945536163 2:211020630-211020652 TCTAGTTCTGTGAAGAATGATGG + Intergenic
945550595 2:211217407-211217429 TCTAGTTCTGTGAAGAATGATGG - Intergenic
945657434 2:212642620-212642642 TCCAGTTCTGTAAAGAATGATGG + Intergenic
946544540 2:220723416-220723438 TCTAGTTCTGTAAAGAATGGTGG + Intergenic
946574545 2:221060216-221060238 TCTAATTCTGTGAAAAATGACGG + Intergenic
946801953 2:223427148-223427170 TCTAGTTCTGTGAAGAATGATGG + Intergenic
946824430 2:223662272-223662294 TCTAGTTCTGTGAAGAATGATGG - Intergenic
947108061 2:226688552-226688574 TCTAGTTCTGTGAAGAATGAGGG + Intergenic
947381941 2:229553345-229553367 ACTAATTCTGCATAGAATGTGGG - Intronic
947452926 2:230224964-230224986 TCAAATCCTTTACAGAATGAGGG + Intronic
947563701 2:231179956-231179978 TCTAATCCTGGAACAAAGGAAGG - Intergenic
948064978 2:235071100-235071122 TCTAATTCTGTGAAGAATGATGG - Intergenic
948353994 2:237362582-237362604 TCTAACCCTGCAAAGAAGTATGG + Intronic
948531513 2:238610221-238610243 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1169335711 20:4754663-4754685 TCTAATTCTGTGAAGAATGATGG + Intergenic
1169401751 20:5287425-5287447 TCTAATTCTGTGAAGAATGATGG - Intergenic
1169517070 20:6328876-6328898 TCTAATTCTGTGAAGAATGATGG + Intergenic
1169624965 20:7555604-7555626 TCTAATTCTGTGAAGAATGATGG + Intergenic
1169722051 20:8688867-8688889 TCTAACTCTGTGAAGAATGATGG + Intronic
1170223818 20:13968954-13968976 TCTATTCATACAAAGTATGAAGG + Intronic
1170245399 20:14216527-14216549 TTTAATTCTGTGAAGAATGATGG + Intronic
1170720657 20:18875218-18875240 TCTAATTCAGTGAAGAATGATGG + Intergenic
1170741404 20:19061070-19061092 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1170862772 20:20123753-20123775 TCTAATTCTGTGAAGAATGATGG + Intronic
1171028918 20:21658519-21658541 TCTAATTCTGTGAAGAATGATGG - Intergenic
1171081226 20:22186762-22186784 TCTAATTCTGTGAAGAATAATGG + Intergenic
1171160092 20:22914059-22914081 TCTAATTCTGTGAAGAATGATGG + Intergenic
1171165968 20:22971675-22971697 TCTAATTCTGTGAAGAGTGATGG - Intergenic
1172469792 20:35184022-35184044 TCTAACTCTGTGAAGAATGATGG - Intergenic
1172850964 20:37964265-37964287 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1172859971 20:38041392-38041414 TCAAATCCTGCAATGAAAGCAGG - Intronic
1173345315 20:42193907-42193929 TCTCATTCTGCAAAGAATTTGGG - Intronic
1174797696 20:53536164-53536186 CCTAACCCTGCAGAGAAGGACGG - Intergenic
1175000061 20:55617922-55617944 TCTAATTCTGTGTAGAATGATGG + Intergenic
1175069450 20:56320323-56320345 TCTAATTCTGTGAAGAATGATGG - Intergenic
1176588603 21:8617261-8617283 TCTAATTCTGTGAAGAATGATGG - Intergenic
1176604419 21:8817089-8817111 TGTAATTCTGTGAAGAATGATGG + Intergenic
1176619416 21:9044761-9044783 TGTAATTCTGTGAAGAATGATGG + Intergenic
1176794201 21:13358914-13358936 TGTAATTCTGTGAAGAATGACGG - Intergenic
1176906455 21:14507668-14507690 TCTAATTCTGTGAAGAACGATGG - Intronic
1176994329 21:15537137-15537159 TCTCATATTGAAAAGAATGAAGG + Intergenic
1177195146 21:17896331-17896353 TCTAATTCTGTGAAGAATGATGG + Intergenic
1177459764 21:21395489-21395511 TCTAATTCTGTGAAGAATTATGG - Intronic
1177579192 21:22997335-22997357 TCTAATTCTGTGAACAATGATGG - Intergenic
1177661545 21:24090096-24090118 TCTAGTCCTGTGAAGAATGATGG - Intergenic
1178054853 21:28786896-28786918 TCTAACTCTGTGAAGAATGATGG - Intergenic
1178059835 21:28839836-28839858 TCTAATTCTGTGAAGAATGGTGG - Intergenic
1178401408 21:32288544-32288566 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1178733298 21:35125302-35125324 TCTAGTTCTGCGAAGAATGATGG - Intronic
1179268499 21:39827724-39827746 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1179443664 21:41415591-41415613 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1179997218 21:44979580-44979602 TCTGCACCTGCAAAGAATGCTGG - Intergenic
1180096637 21:45558377-45558399 GCGAATCCTTCAAAGATTGAAGG - Intergenic
1180251120 21:46589893-46589915 TCTAATTCTGTTAAGAATGATGG - Intergenic
1180271432 22:10594255-10594277 TCTAATTCTGTGAAGAATGATGG - Intergenic
1180346710 22:11708696-11708718 TGTAATTCTGTGAAGAATGATGG + Intergenic
1180454521 22:15500719-15500741 TGTAATTCTGTGAAGAATGATGG + Intergenic
1180472567 22:15673855-15673877 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1181448981 22:23003683-23003705 TCTATTTCTGTAAAGAATGTTGG - Intergenic
1181930691 22:26399011-26399033 TCTTTTACTGCCAAGAATGAAGG - Intergenic
1182201043 22:28570429-28570451 TCTGTTCCTGCTTAGAATGATGG - Intronic
1183047981 22:35236271-35236293 TCTAACTCTGTGAAGAATGATGG + Intergenic
1184810043 22:46825068-46825090 TTTAATTCTGCAAAGAAGGGTGG + Intronic
949138718 3:604505-604527 TCTAATTCTGTGAAGAATGATGG + Intergenic
949727427 3:7065712-7065734 TCTAATTCTGTGAAGAATGATGG + Intronic
950598871 3:14012924-14012946 TCTAGTTCTGTGAAGAATGATGG + Intronic
950819911 3:15745732-15745754 TCTAATTCTGTGAAGAATGATGG + Intronic
951434374 3:22644317-22644339 TCTAACTCTGTGAAGAATGATGG + Intergenic
951434899 3:22650571-22650593 TCTAATTCTGTGAGGAATGATGG - Intergenic
951444031 3:22756108-22756130 TCTAATTCTGTGAAGAATGAGGG - Intergenic
951463333 3:22974791-22974813 TCTAAGTCTGTAAAGAATGATGG - Intergenic
951572063 3:24074600-24074622 TCTAATTCTGTGAAGAATGATGG + Intergenic
951575942 3:24114196-24114218 TCTAATCCTCCAAACAAATATGG - Intergenic
951761413 3:26151384-26151406 TCTAATTCTGTAAAGAATGATGG - Intergenic
951763865 3:26174984-26175006 TTTAATTCTGTGAAGAATGATGG + Intergenic
952024301 3:29059975-29059997 TCTAGTTCTGTGAAGAATGATGG - Intergenic
952689489 3:36187936-36187958 TTTAATTCTGCGAAGAATGACGG + Intergenic
952994158 3:38861361-38861383 TCTAGTCCTGTGAAGGATGACGG - Intronic
953004195 3:38962389-38962411 TCTAATTCTGTGAAGAATGATGG + Intergenic
953166363 3:40468715-40468737 TTTAATTTTGAAAAGAATGACGG - Intergenic
953185709 3:40636257-40636279 TCTAACCCTGCAAAGAATTATGG - Intergenic
953866903 3:46591819-46591841 TCTAATTCTGTGAAGAATGATGG - Intronic
954479438 3:50784532-50784554 TCTAGTTCTGTGAAGAATGATGG + Intronic
955175259 3:56607164-56607186 TCTAACTCTGTGAAGAATGATGG + Intronic
955450410 3:59060368-59060390 TCTAGTTCTGTGAAGAATGATGG + Intergenic
955477165 3:59349323-59349345 TCTAATTCTGTGAAGAATGATGG + Intergenic
955526283 3:59823313-59823335 TCTAATTCTGTGAAGAATGATGG + Intronic
955534471 3:59908499-59908521 CACCATCCTGCAAAGAATGATGG + Intronic
955859728 3:63315257-63315279 TCTAATTCTGTGAAGAATGATGG + Intronic
956872735 3:73434317-73434339 TTTAATGCTGCAGATAATGATGG + Intronic
957015857 3:75064341-75064363 TCTAATTCTGTGAAGAATGATGG + Intergenic
957312440 3:78538397-78538419 TCTAGTTCTGTGAAGAATGATGG + Intergenic
957476159 3:80726973-80726995 TCTAATTCTGTGAAGAATGATGG + Intergenic
957772460 3:84712032-84712054 TCTAATTCTGTGAAGAATGATGG - Intergenic
957969768 3:87367636-87367658 TCAAGTCCAGCAAAGAATTAAGG + Intergenic
958014175 3:87918843-87918865 TCTAATTCTGTGAAGAATGATGG - Intergenic
958087945 3:88836733-88836755 TCTAATTCTGTGAAGAATGATGG + Intergenic
958480419 3:94639072-94639094 TCTAATTCTGTGAAGAATAATGG + Intergenic
958480425 3:94639205-94639227 TCTAATTCTGTGAAGAATGATGG + Intergenic
958490237 3:94763415-94763437 TGTAATTCTGTGAAGAATGATGG + Intergenic
958577967 3:95976586-95976608 TCTCATTCTGTGAAGAATGACGG - Intergenic
958771037 3:98426193-98426215 TCTAATTCTGTGAAGCATGATGG - Intergenic
958775280 3:98475225-98475247 TCTAATTTTGTGAAGAATGATGG + Intergenic
959009371 3:101057084-101057106 TCTAGTTCTGTGAAGAATGATGG + Intergenic
959039908 3:101409408-101409430 TCTAATTCTGTGAAGAATGATGG - Intronic
959274950 3:104266802-104266824 TCTAATTCTATGAAGAATGATGG + Intergenic
959325292 3:104929286-104929308 TCTAATTCTGTGAAGAATGATGG + Intergenic
959424178 3:106165882-106165904 TCTAGTTCTGTGAAGAATGATGG - Intergenic
959436543 3:106321862-106321884 TCTAATTCTGTGAAGAATGATGG - Intergenic
959715322 3:109426601-109426623 TCTAGTTCTGTGAAGAATGATGG + Intergenic
959721932 3:109501380-109501402 TCAAATTCTGTGAAGAATGATGG + Intergenic
959875508 3:111377856-111377878 TCTAATTCTGTGAAAAATGATGG - Intronic
959899488 3:111643955-111643977 TCTAATTCTGCAAAGAATGATGG - Intronic
960264801 3:115608316-115608338 TCTAGTTCTGTGAAGAATGATGG + Intergenic
960512439 3:118567221-118567243 TCTAATTCTGTGAAGAATGATGG + Intergenic
960516955 3:118612721-118612743 TCTAATTCTATAAAGAATGATGG - Intergenic
960756822 3:121023363-121023385 TCTAGTTCTGTGAAGAATGATGG - Intronic
961264346 3:125628891-125628913 TCTAATTCTGTGAAGAATGATGG + Intergenic
961316755 3:126042000-126042022 CCTAATCCTAGAAAGAAAGAAGG + Intronic
962401480 3:135063208-135063230 TCTAATTCTGTGAAGAATGTTGG + Intronic
962494465 3:135925168-135925190 TCAAATCCTGCAAAGATTTCTGG + Intergenic
962707150 3:138055031-138055053 GCTATTCCTGCAAAAAATGTTGG - Intergenic
962821231 3:139049176-139049198 TCAAATTCTGTGAAGAATGATGG + Intronic
962999761 3:140668335-140668357 TCTAGTTCTGTGAAGAATGATGG - Intergenic
963173455 3:142274543-142274565 TCTAATTCTGTGAAGAATGATGG + Intergenic
963213636 3:142721675-142721697 TCTAGTTCTGTGAAGAATGATGG - Intergenic
963699727 3:148609466-148609488 TCTAATTCTGTGAAGAATGATGG + Intergenic
964166277 3:153709647-153709669 TCTAATTCTGTGAAGAATGATGG - Intergenic
964190001 3:153990655-153990677 TCTAATTCTGTGAAGAATGATGG - Intergenic
964252820 3:154739386-154739408 TCTAATGCTGTGAAGAATGATGG + Intergenic
964600868 3:158499403-158499425 TCTAATTCTGTGAAGAATGATGG + Intronic
964644210 3:158941055-158941077 TCTAATTCTGTGAAAAATGATGG - Intergenic
964892146 3:161549960-161549982 TGTAATCTTGCAAAGTATCAAGG - Intergenic
964909870 3:161767292-161767314 TGTTATCATGCAAAGATTGAGGG - Intergenic
965114274 3:164467521-164467543 TCTACTCTCTCAAAGAATGAAGG + Intergenic
965197150 3:165615245-165615267 TTGAAAACTGCAAAGAATGAGGG + Intergenic
965296280 3:166951078-166951100 TCTAGTTCTGTGAAGAATGATGG + Intergenic
965992665 3:174838964-174838986 TCTAATTCTGTGAAGAATGGTGG - Intronic
966037718 3:175440406-175440428 TCTAGTTCTGTTAAGAATGATGG + Intronic
966229526 3:177636393-177636415 TCTAGTTCTGTGAAGAATGATGG + Intergenic
966369438 3:179232628-179232650 TCTAATTCTGTGAAAAATGATGG + Intronic
966467180 3:180243147-180243169 TCTAATTCTGTGAAGAATTATGG + Intergenic
966492039 3:180538746-180538768 TCTAGTTCTGTGAAGAATGATGG + Intergenic
966552931 3:181225453-181225475 TCTAGTTCTGTGAAGAATGATGG + Intergenic
966578282 3:181528563-181528585 TCTAGTTCTGTGAAGAATGATGG + Intergenic
966686631 3:182703009-182703031 TCTAATTCTGTGGAGAATGATGG + Intergenic
966749442 3:183307950-183307972 TGTAATCATGCAAAGACTTAGGG - Intronic
966991994 3:185242286-185242308 TCTAATTCTGTGAAGAATAATGG - Intronic
967209444 3:187154742-187154764 TCTAATTCTGTGAAGAATGATGG - Intronic
967491079 3:190091650-190091672 GATAATTCTGAAAAGAATGATGG + Intronic
967491224 3:190093065-190093087 TAAAATCATGAAAAGAATGAAGG + Intronic
967559257 3:190899166-190899188 TCTAATTCTGTTAAGAATGATGG - Intergenic
967958335 3:194896682-194896704 TCTAGTTCTGCAAAGCATGATGG + Intergenic
968245819 3:197146271-197146293 TCTAGTTCTGTGAAGAATGATGG - Intronic
969171024 4:5363655-5363677 TCTAATCAGCCAAAGAATTATGG + Intronic
969947273 4:10797259-10797281 TCTAATTCTGTGAAGAATGATGG - Intergenic
970269680 4:14331971-14331993 TCTAGTTCTGTGAAGAATGATGG + Intergenic
970284019 4:14489187-14489209 TCTAGTTCTGTGAAGAATGATGG - Intergenic
970291210 4:14574492-14574514 TACAAACCTGTAAAGAATGATGG - Intergenic
970346357 4:15156212-15156234 TCTAATTCTGTGAAGAATGATGG + Intergenic
970452638 4:16186087-16186109 TCTAATCCTAAAAAGTGTGAAGG - Intronic
970813813 4:20128881-20128903 TCAAATCCTGAAAAGATCGAGGG + Intergenic
970926036 4:21453510-21453532 TCACATCCTGGAAAGAGTGAGGG - Intronic
970996489 4:22273355-22273377 TCTAATTCTGTGAAGAATGATGG - Intergenic
971182745 4:24345281-24345303 TGTAATTCTGTGAAGAATGATGG + Intergenic
971276270 4:25200376-25200398 TCTAATTCTGTGAAGAATGATGG - Intronic
971962166 4:33503142-33503164 TCTAGTTCTCCAAAGAATGATGG + Intergenic
972943222 4:44222408-44222430 GCTACTCCTGCACAGAATCAAGG - Intronic
973113339 4:46423159-46423181 TCTAGTTCTGTGAAGAATGATGG + Intronic
973179214 4:47247542-47247564 TCTAATTCTATGAAGAATGATGG + Intronic
973373705 4:49273888-49273910 TGTAATTCTGTGAAGAATGATGG - Intergenic
973383707 4:49336351-49336373 TGTAATTCTGTGAAGAATGATGG + Intergenic
973730924 4:53821694-53821716 TCTAGTCCTGAAATGAATGATGG - Intronic
973782818 4:54305293-54305315 TCTAATTCTGTGAAGAATGATGG - Intergenic
974008961 4:56589455-56589477 TCTAATTTTGTGAAGAATGATGG + Intronic
974011329 4:56610070-56610092 TCTAATTCTGTGAAGAATGATGG - Intergenic
974258547 4:59494321-59494343 TCTAGTTCTGTGAAGAATGATGG + Intergenic
974815820 4:67002154-67002176 TCTAGTTCTGTGAAGAATGATGG + Intergenic
975517670 4:75264788-75264810 TCTAGTTCTGTGAAGAATGATGG - Intergenic
975534934 4:75440017-75440039 TCTAGTTCTGTGAAGAATGATGG - Intergenic
975670628 4:76777119-76777141 TCTAGTTCTGTGAAGAATGATGG + Intronic
976445397 4:85125429-85125451 TCTAGTTCTGTGAAGAATGATGG + Intergenic
976464363 4:85350930-85350952 TCTCATTCTGTGAAGAATGATGG + Intergenic
976556567 4:86457777-86457799 TCTAATTCTGTGAAGAATGATGG - Intronic
976685950 4:87815196-87815218 TCTAATTCTGTGAAGAATGATGG + Intergenic
976869562 4:89774595-89774617 TCTAGTTCTGTGAAGAATGATGG - Intronic
976888432 4:90014208-90014230 TCTGATCCTGTAAAAACTGATGG - Intergenic
976919015 4:90413418-90413440 TCTAGTTCTGCAAAGAATAATGG - Intronic
976920416 4:90434418-90434440 TATAAGCCTGGAAAAAATGATGG - Intronic
977226168 4:94394395-94394417 TCTACTTCTGTGAAGAATGATGG - Intergenic
977474295 4:97485676-97485698 TATAATTCTGTGAAGAATGATGG - Intronic
977549691 4:98427830-98427852 TCTAGTTCTGTGAAGAATGATGG - Intronic
977825970 4:101531973-101531995 TCTAATTCTGTGAAGAATGATGG + Intronic
977826456 4:101537967-101537989 TCTAGTTCTGTAAAGAATTATGG - Intronic
977904487 4:102459787-102459809 TCTAACTCTGTGAAGAATGATGG - Intergenic
977906952 4:102488061-102488083 TCTAATTCTGTGAAGAATGATGG - Intergenic
977975737 4:103264373-103264395 TCTAGTTCTGTGAAGAATGATGG + Intergenic
978050846 4:104197986-104198008 TCTAGTTCTGTGAAGAATGATGG + Intergenic
978113855 4:104995311-104995333 TCTAGTTCTGTGAAGAATGATGG + Intergenic
978128921 4:105170098-105170120 CCTAATTCTGTGAAGAATGATGG + Intronic
978726295 4:111973438-111973460 TCTAATTCTGTGAAGAATTATGG + Intergenic
978757523 4:112319565-112319587 TCTAATTCTGTGAAAAATGATGG + Intronic
978762197 4:112365675-112365697 TCTAGTTCTGTGAAGAATGATGG - Intronic
978858119 4:113416466-113416488 TCTAATTCTGCGAAGAATGATGG + Intergenic
978917199 4:114141553-114141575 TCTAGTTCTGTGAAGAATGATGG + Intergenic
979156495 4:117398131-117398153 TCTAATTCTGTGAAAAATGATGG - Intergenic
979381720 4:120014218-120014240 TCTAATTCTGTGAAGAATGATGG + Intergenic
979435102 4:120678943-120678965 TCTAATTCTGTGAAGAATGATGG - Intergenic
979498071 4:121407188-121407210 TCTCATTCTGCAAAGAATGATGG + Intergenic
979705873 4:123719997-123720019 TCTAATTTTGTGAAGAATGATGG - Intergenic
979794211 4:124825499-124825521 TCTAATCCTGCCAAAAATAATGG - Intergenic
979794558 4:124830591-124830613 TCTAATTCTGTGATGAATGATGG + Intergenic
979995807 4:127429445-127429467 TCTAACTCTGTGAAGAATGATGG - Intergenic
980086831 4:128399664-128399686 TCTAATTCTGTGAAGAATGATGG + Intergenic
980152838 4:129069296-129069318 TCTAATTCTGTGAAGAATAATGG + Intronic
980263395 4:130483500-130483522 TCTAGTTCTGTAATGAATGATGG - Intergenic
980580420 4:134743318-134743340 CCTAATTCTGTGAAGAATGATGG - Intergenic
981079961 4:140629838-140629860 ACTAATCATGAAAATAATGACGG + Intronic
981218920 4:142208446-142208468 TCTACATCTGCAAAGAATGCAGG - Exonic
981351569 4:143735822-143735844 TCTAGTTCTGTGAAGAATGATGG + Intergenic
981400560 4:144309107-144309129 TCTAATTCTGTGAAGAGTGATGG + Intergenic
981559781 4:146034356-146034378 TCTAATTCTGTGAAGAATGATGG - Intergenic
981626358 4:146760406-146760428 TCTAATTTTGTGAAGAATGATGG - Intronic
981672941 4:147308538-147308560 TCTAATGCTGCAAAAAAGGAGGG - Intergenic
981760378 4:148188238-148188260 TCTAATTCTGCGAAGAATGATGG + Intronic
982119227 4:152124819-152124841 TCTAATTCTGTGAAGAATGATGG + Intergenic
982189383 4:152838295-152838317 TCTAATTCCGTGAAGAATGATGG + Intronic
982218385 4:153102936-153102958 TCTAATTCTGTGAAGAATGATGG + Intergenic
982311923 4:153995268-153995290 TCTAATTCTGTGAAGAATGGTGG + Intergenic
982531619 4:156551842-156551864 TCTAGTTCTGTGAAGAATGATGG + Intergenic
982631011 4:157829168-157829190 TCTAATTCTGTGAAGGATGATGG - Intergenic
982679732 4:158414666-158414688 TCTAACTCTGTGAAGAATGATGG + Intronic
982845101 4:160242505-160242527 TCTAATTCTGTGAAAAATGATGG + Intergenic
983010812 4:162544538-162544560 TCTAGTGCTGTGAAGAATGATGG + Intergenic
983052643 4:163066808-163066830 TCTAATTCTGTGAATAATGATGG - Intergenic
983067097 4:163223911-163223933 TCTAGTTCTGTGAAGAATGATGG - Intergenic
983544509 4:168948887-168948909 TCTAATTCTGTGAAGAATGATGG + Intronic
983685438 4:170402810-170402832 TCTAATTCTATGAAGAATGATGG + Intergenic
984031545 4:174610607-174610629 TCTCCTCTTTCAAAGAATGAAGG + Intergenic
984066881 4:175059240-175059262 TCTAGTTCTGTGAAGAATGATGG - Intergenic
984266285 4:177500946-177500968 TCTAATTCTGTGAGGAATGATGG + Intergenic
984324120 4:178229977-178229999 CCTAATTCTGTAAAAAATGATGG - Intergenic
984474721 4:180221442-180221464 TCTAATTCTGTGAAGAATGATGG + Intergenic
984511215 4:180680806-180680828 TCAAAAGCTGCAAAGATTGAGGG + Intergenic
984527173 4:180871314-180871336 TCTAAACTTGTGAAGAATGATGG + Intergenic
984576887 4:181460804-181460826 AATATTCCTGCAAAGAAAGAAGG - Intergenic
985008302 4:185556878-185556900 TCTAATTCTGTGAAGAATGATGG + Intergenic
985093284 4:186386055-186386077 TCTAATTCTGTGAAGAATGATGG - Intergenic
985110950 4:186546152-186546174 AATAATCCTGCAAAGGAAGATGG - Intronic
985227075 4:187773067-187773089 TCTTCTCTTGCAATGAATGAAGG - Intergenic
985284457 4:188321027-188321049 TCTAGTTCTGTGAAGAATGATGG - Intergenic
986259376 5:6130410-6130432 TCTAATTTTGTGAAGAATGATGG - Intergenic
986471054 5:8075448-8075470 TCTAAATCTGTAAAAAATGATGG - Intergenic
986617521 5:9634468-9634490 TCTAGTTCTGTGAAGAATGATGG + Intronic
986634393 5:9806367-9806389 TCTAGTTCTGTGAAGAATGATGG - Intergenic
986870600 5:12040946-12040968 TCTAATACTGTGAAGAATGATGG - Intergenic
987316564 5:16730007-16730029 ATTAATCCTGGAAAGAATCAGGG - Intronic
987381381 5:17289035-17289057 TCTAATCATCCCAAGGATGAAGG - Intergenic
987414103 5:17644805-17644827 TCTAATTCTATAAATAATGATGG + Intergenic
987687453 5:21223620-21223642 TCCAATCCTACAAAAAAAGAAGG + Intergenic
987902435 5:24030214-24030236 TCTAATTCTGTGAAGAATGAAGG + Intronic
988104878 5:26731779-26731801 TCTAATTCTGTGAATAATGATGG + Intergenic
988624317 5:32855066-32855088 TCTAGTTCTGTGAAGAATGATGG - Intergenic
989355082 5:40534848-40534870 TCTAGTTCTGTGAAGAATGAGGG + Intergenic
989533423 5:42535679-42535701 TCTAATTCTGTGAAGAATGATGG + Intronic
989564477 5:42888359-42888381 TGTTATCCTGCAAACAGTGAGGG + Intergenic
990029280 5:51237073-51237095 TCTGATCCTGAAGAGAATGGAGG - Intergenic
990233711 5:53743480-53743502 TCTAATTCTGTGAAGAATGATGG - Intergenic
990243916 5:53843431-53843453 TCTAGTTCTGTGAAGAATGATGG - Intergenic
990589606 5:57249201-57249223 TCTTATCCCACAAACAATGAAGG - Intronic
990673032 5:58153786-58153808 TCTAATTCTGTGAAGAATGATGG - Intergenic
990712455 5:58600361-58600383 TCTAATTCTGTGAAGAATAATGG + Intronic
990775761 5:59303912-59303934 TCTAATTCTGTGAAGAATGATGG + Intronic
991543521 5:67756283-67756305 TCTATTTCTGTGAAGAATGATGG - Intergenic
991611415 5:68453652-68453674 TTTAATTCTTCAAAGAATTAGGG + Intergenic
991623337 5:68569843-68569865 TCTAGTTCTGTGAAGAATGATGG - Intergenic
991924254 5:71688530-71688552 TCTAATTCTGTGAAGAATGATGG - Intergenic
991968386 5:72114248-72114270 TCCTATCCTGTAAAGAATCAAGG - Intronic
992339710 5:75810353-75810375 TCTAATTCTGTGAAGAATGATGG + Intergenic
992892709 5:81218720-81218742 TCTAATTCTGTGAAGAATGATGG + Intronic
992899054 5:81274865-81274887 TCTAGTTCTGTGAAGAATGATGG - Intergenic
992967346 5:82016602-82016624 TCCAGTTCTGTAAAGAATGATGG + Intronic
993171394 5:84423904-84423926 TCTGATGCTGCAAGGCATGAGGG - Intergenic
993249970 5:85509124-85509146 TCTAATTCTGTGAAGAATGATGG + Intergenic
993445220 5:88003667-88003689 TCTAGTTCTGTGAAGAATGATGG - Intergenic
993661037 5:90635461-90635483 TCTAATACTGTAAACGATGATGG - Intronic
993743641 5:91569134-91569156 TCTAGTTCTGTGAAGAATGATGG - Intergenic
993753251 5:91696514-91696536 TCTAGTTCTGTGAAGAATGATGG + Intergenic
993883510 5:93390629-93390651 TCTAATTCTGTGAAGAATGATGG + Intergenic
993896391 5:93540436-93540458 ACTAGAGCTGCAAAGAATGATGG - Intergenic
993917435 5:93760370-93760392 TCTAATTCTGTGAAGAATGATGG - Intronic
993948198 5:94140058-94140080 TCTAGTTCTGTGAAGAATGATGG + Intergenic
993965180 5:94351558-94351580 TCTAATTCTGTGAAGAATGATGG - Intronic
994510324 5:100695049-100695071 CCTCATACTGCAAAGAATAATGG - Intergenic
994595328 5:101825515-101825537 TCTAATTCTGTGAAGAATGATGG - Intergenic
994659324 5:102634846-102634868 TCTAATTCTGTGAAGAATGATGG - Intergenic
994777774 5:104056860-104056882 TCTAGTTCTGTGAAGAATGAAGG + Intergenic
994896959 5:105718913-105718935 TCTAGTTCTGTGAAGAATGATGG - Intergenic
995161346 5:108986967-108986989 TCTAGTTCTGTCAAGAATGATGG + Intronic
995293377 5:110486838-110486860 TCTAATTCTGTTTAGAATGATGG + Intronic
995351300 5:111178817-111178839 TCTAATTCTGTGAAGAATGATGG + Intergenic
995406185 5:111799289-111799311 TCTAGTTCTGTGAAGAATGATGG + Intronic
995450808 5:112298149-112298171 TCTAGTTCTGTGAAGAATGATGG + Intronic
995472633 5:112519152-112519174 TCTAATTCTGTGAAGAATGATGG + Intergenic
995955776 5:117774654-117774676 TCTAATTCTGTGAAGAATGATGG - Intergenic
996123674 5:119700880-119700902 CCTAATTCTGTGAAGAATGATGG + Intergenic
996284957 5:121778971-121778993 TCTAATTCTGTGAAGAATGATGG - Intergenic
996288571 5:121824992-121825014 TCTAATTCTGTGAAGAATGATGG + Intergenic
996325790 5:122271683-122271705 TCTAATTCTGTGAAGAATGATGG - Intergenic
996490958 5:124095617-124095639 TCTAGTTCTGCGAAGAATGATGG + Intergenic
996663670 5:126032999-126033021 TCTAATGTTGCAAAGAAAGAGGG + Intergenic
996834981 5:127781352-127781374 TCTAATTCTGTGAAGAATGATGG + Intergenic
996875032 5:128231119-128231141 TCTAGTTCTGTAAAGAATGATGG + Intergenic
996925294 5:128818842-128818864 TTTAATTCTTCAAAGATTGAAGG - Intronic
996961980 5:129262199-129262221 TCTAGTTATGTAAAGAATGATGG - Intergenic
997105608 5:131015817-131015839 TCTAATTCTGTGAAGAATGAAGG + Intergenic
997288832 5:132708562-132708584 TCTAATCCTGCTCAGAATAAGGG - Intronic
997761230 5:136449954-136449976 TCTAATTCTGTGAAGAATGATGG - Intergenic
997763581 5:136475423-136475445 TCTAATTCTGTGAAGAATAATGG + Intergenic
997765142 5:136495583-136495605 TCTAATTCTTTGAAGAATGATGG + Intergenic
997780299 5:136651200-136651222 TCTAGTTCTGTGAAGAATGATGG + Intergenic
998603509 5:143609363-143609385 TCTAATTCTGTGAAGAATGATGG - Intergenic
998634980 5:143943376-143943398 TCTAGTTCTGTGAAGAATGATGG + Intergenic
998918237 5:147039488-147039510 TCTAATTCTGCACAGAATGTGGG - Intronic
998941248 5:147284921-147284943 TCTAATTCTGTGAAGAATGATGG - Intronic
999248934 5:150170180-150170202 TCCACTCTTGCAAAGAATCAGGG - Intronic
999343374 5:150793290-150793312 TCTAATTCTGTGAGGAATGATGG - Intronic
999490792 5:152048894-152048916 TCTAGTTCTGTGAAGAATGATGG + Intergenic
999526226 5:152409130-152409152 TCTAATTCTGTGAAGAATGATGG + Intronic
999599508 5:153246121-153246143 TCTAATTCTGTGAACAATGATGG + Intergenic
999800907 5:155034862-155034884 TCTAATTCTGTGAAGAAAGACGG + Intergenic
999819121 5:155207478-155207500 TCTAATTCTGTGAAGAATGATGG - Intergenic
999913106 5:156227626-156227648 TCGAATTCTGTGAAGAATGATGG + Intronic
1000191697 5:158917298-158917320 TGTATTGCTGGAAAGAATGAGGG - Intronic
1000271899 5:159693703-159693725 TCTAGTTCTGTAAAGAATGATGG - Intergenic
1000403851 5:160865042-160865064 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1000433793 5:161183028-161183050 TATAATGCTGCAATGAATGTGGG - Intergenic
1000510828 5:162180393-162180415 TCTAATTCTGTGAAGAATGATGG + Intergenic
1000511245 5:162186056-162186078 TCTAATTCTGTGAAGAATGATGG + Intergenic
1000592842 5:163179358-163179380 TCTAATTCTGTGAAGAATGATGG + Intergenic
1000615940 5:163426757-163426779 TCTAATTCTGTGAAGAATTATGG - Intergenic
1000713353 5:164607936-164607958 TCTAATTCTGTGAAGAATGATGG - Intergenic
1000780136 5:165469963-165469985 TCTAATTCTGTGAAGACTGATGG - Intergenic
1000821294 5:165987670-165987692 TTTAATTCTGTAAAGACTGATGG + Intergenic
1000861767 5:166464393-166464415 TTTAATTCTGTGAAGAATGATGG + Intergenic
1001176797 5:169476848-169476870 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1002747378 6:69938-69960 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1002825454 6:768789-768811 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1003063549 6:2882112-2882134 TCTAACTCTGTGAAGAATGATGG - Intergenic
1003269690 6:4596772-4596794 TCTAACTCTGTGAAGAATGATGG + Intergenic
1003297107 6:4839940-4839962 TCTAGTTCTGTGAAGAATGATGG + Intronic
1003465317 6:6374719-6374741 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1003582401 6:7352513-7352535 TCTAATTCTGTGAAGAATGATGG - Intronic
1003711603 6:8598475-8598497 TCTAATTCTGTGAGGAATGATGG + Intergenic
1003929935 6:10914525-10914547 TCTAATTCTGTGAAGAATGATGG + Intronic
1004081553 6:12399385-12399407 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1004294046 6:14394310-14394332 TCCAATTCTGCAAAGAATCAAGG - Intergenic
1004777923 6:18869780-18869802 TCTAATTCTGTGAAGAATGATGG - Intergenic
1004888909 6:20079053-20079075 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1005107705 6:22243068-22243090 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1005760815 6:28966330-28966352 TCTAATTCTGTGAAGAATGATGG - Intergenic
1005792818 6:29323779-29323801 TCTAATTCTGTGAAGAATGGTGG + Intergenic
1006279905 6:33043171-33043193 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1007131565 6:39479619-39479641 TCTAGTTCTGTAAAGAATGATGG + Intronic
1007170852 6:39862367-39862389 TCAAATCATGGAAAGAAGGAAGG + Intronic
1008115885 6:47549679-47549701 TCTAATTCTGTGAAGAATGATGG - Intronic
1008121320 6:47620570-47620592 TCCAATTCTGTGAAGAATGATGG + Intronic
1008416150 6:51242956-51242978 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1008447381 6:51609094-51609116 TCTAAGCTTTCAAAGAATGTTGG + Intergenic
1008775039 6:55027889-55027911 TCTAAGTCTGTGAAGAATGATGG + Intergenic
1008973196 6:57394184-57394206 TCTAATTCTGTGAAGAATGATGG + Intronic
1009332158 6:62437058-62437080 TCCAATTCTGTAAAGAATAATGG + Intergenic
1009395530 6:63194996-63195018 TCTAATTCTGTGAAGAATGATGG + Intergenic
1009512217 6:64567544-64567566 TGCAATACTGGAAAGAATGAAGG + Intronic
1009522750 6:64705446-64705468 CCTAGTTCTGTAAAGAATGATGG - Intronic
1009589427 6:65647133-65647155 TCTAGTTCTGTGAAGAATGATGG - Intronic
1009867460 6:69415050-69415072 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1009969393 6:70610805-70610827 TCTAATTCTGTGAAGAATGATGG - Intergenic
1010008621 6:71024732-71024754 TCTAATTCTGTGAAGAATGATGG + Intergenic
1010028041 6:71242422-71242444 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1010045722 6:71440964-71440986 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1010075996 6:71799106-71799128 TCTAATTCTGTGATGAATGATGG + Intergenic
1010164728 6:72901869-72901891 TCTAATTCTGTGAAGAATGATGG + Intronic
1010181526 6:73091852-73091874 TCTAATTCTGTGAAGAATGATGG + Intronic
1010380805 6:75222780-75222802 TGTAATCTTGGAAAGAATAAGGG - Intergenic
1010413232 6:75584580-75584602 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1010458814 6:76089441-76089463 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1010486501 6:76420915-76420937 TCTAATGGGGCAAAGAGTGAGGG + Intergenic
1010707352 6:79130713-79130735 TCTAATTCTGTGAAGAATGATGG + Intergenic
1010840613 6:80645604-80645626 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1011132730 6:84068407-84068429 GCTAATTCTGTGAAGAATGATGG + Intronic
1011169010 6:84483630-84483652 TCTAATTCTGTGAAGAAGGATGG - Intergenic
1011225553 6:85101604-85101626 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1011319609 6:86076339-86076361 TCTAGTTCTGTAAAGAATGGTGG + Intergenic
1011327510 6:86166024-86166046 TCTAATTCCGTGAAGAATGATGG - Intergenic
1011328708 6:86179693-86179715 TCTAATTCTGTGAAGAATGATGG + Intergenic
1011331281 6:86209755-86209777 TAGAATCCAGCAAGGAATGAAGG - Intergenic
1011568115 6:88702181-88702203 TCTAATTCTGTGAAAAATGATGG - Intronic
1011619763 6:89231548-89231570 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1011789350 6:90881331-90881353 TCTAATTCTGTGAAGAATGATGG + Intergenic
1011947550 6:92925225-92925247 TCTGATTCTGTGAAGAATGATGG + Intergenic
1012156274 6:95823406-95823428 TCTGATTCTGTGAAGAATGATGG - Intergenic
1012634288 6:101516206-101516228 TCTAATTCTGTGAAGAATGATGG - Intronic
1012717204 6:102690492-102690514 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1012794184 6:103738857-103738879 TCTAATTCTATGAAGAATGATGG - Intergenic
1012923119 6:105240198-105240220 TCTAACTCTGTGAAGAATGATGG - Intergenic
1012942620 6:105431321-105431343 TTTTATCATGCATAGAATGAAGG + Intergenic
1013405897 6:109843254-109843276 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1013553630 6:111234532-111234554 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1013850729 6:114511531-114511553 TCTAATTCTGTGAAGAATGATGG - Intergenic
1013900635 6:115152055-115152077 TCTAATTCTGCGAAGAATGGTGG + Intergenic
1014108782 6:117596908-117596930 TCTAGTTCTGTGAAGAATGATGG + Intronic
1014285423 6:119491792-119491814 TCTAATTCTGTGAGGAATGATGG - Intergenic
1014304471 6:119723330-119723352 TCTAATTCTGTGAAGAATTATGG + Intergenic
1014337211 6:120151634-120151656 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1014531024 6:122559565-122559587 TCTAATTCTGTGAAGAATGATGG + Intronic
1014604267 6:123452720-123452742 TCTAACTCTGCGAAGAATTACGG - Intronic
1014853503 6:126370291-126370313 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1015222521 6:130820881-130820903 TCTAATTCTATGAAGAATGATGG - Intergenic
1015348215 6:132184754-132184776 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1015488707 6:133800688-133800710 TCTTATCCTGCAAAGTACCATGG + Intergenic
1015565949 6:134571481-134571503 TCTAATTCTGCAAAGAATGATGG - Intergenic
1015643905 6:135365329-135365351 TCTAGTTCTGCGAAAAATGATGG + Intronic
1015662535 6:135591249-135591271 TCTAATCCTGTACACAATCAGGG - Intergenic
1015662929 6:135596234-135596256 TCTAATTCTGTAAAGAATGATGG + Intergenic
1015688764 6:135896676-135896698 CCTAAGCATGCAAAAAATGATGG + Intronic
1015807774 6:137129062-137129084 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1015849324 6:137555341-137555363 TCTAATTCTTTGAAGAATGATGG + Intergenic
1016057931 6:139598188-139598210 TCTCGTCCTGCCAAGAATGGTGG + Intergenic
1016365903 6:143318116-143318138 TCTAATTCTGTGAATAATGATGG - Intronic
1016435376 6:144031872-144031894 TCTAGTTCTGTGAAGAATGATGG + Intronic
1016581749 6:145636047-145636069 TCTAATGCTGCAAGGTAAGAAGG + Intronic
1017214531 6:151894908-151894930 TCTAGTTCTGTGAAGAATGATGG + Intronic
1017295460 6:152788529-152788551 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1017351284 6:153445139-153445161 TCTCATCTCGCAAAGAAGGAAGG - Intergenic
1017374550 6:153753092-153753114 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1017534897 6:155336588-155336610 TCTAATTCTGTGAAGAATGATGG + Intergenic
1018352977 6:162981559-162981581 TCTAGTTCTGTAAAGAAAGATGG + Intronic
1018353328 6:162986182-162986204 TCTAGTTCTGTAAAGAATGATGG - Intronic
1018597132 6:165493304-165493326 TCTAGTTCTGTGAAGAATGATGG - Intronic
1019590854 7:1830457-1830479 TCTACTCCTTCCATGAATGAGGG + Intronic
1020348685 7:7193698-7193720 CCTAGCTCTGCAAAGAATGATGG + Intronic
1020602168 7:10289829-10289851 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1020861168 7:13493690-13493712 TCTAATTCTGTGAAGAATGATGG - Intergenic
1020915337 7:14185486-14185508 TCTAATTCTGTGAAGAATGATGG - Intronic
1021176398 7:17454831-17454853 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1021183649 7:17537476-17537498 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1021473721 7:21036216-21036238 TCTAATTCTGTGAAGAATAATGG + Intergenic
1021779535 7:24089217-24089239 TCTAATTTTGTGAAGAATGATGG + Intergenic
1022254209 7:28639900-28639922 CCTACTCCTGCAAAAAATGACGG + Intronic
1022295731 7:29050712-29050734 TCGAATTCTGTGAAGAATGATGG - Intronic
1022800819 7:33775688-33775710 TCTAAGTCCCCAAAGAATGATGG + Intergenic
1023748549 7:43347014-43347036 TCTAATGCTGTGAAGAATGATGG + Intronic
1023902768 7:44496503-44496525 TCTAATCATGGGAAGAATGTTGG + Intergenic
1024366953 7:48531514-48531536 TCTAGTTCTGTGAAGAATGATGG + Intronic
1024545925 7:50518356-50518378 TCTATTTCTGTGAAGAATGATGG - Intronic
1024668919 7:51573330-51573352 CCTAATTCTGTGAAGAATGATGG + Intergenic
1024744977 7:52395686-52395708 TCTAATTCTGTGAAGGATGATGG + Intergenic
1024840283 7:53577676-53577698 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1024916854 7:54511111-54511133 TCTAATTATGTGAAGAATGATGG + Intergenic
1024917729 7:54522526-54522548 TCTAATTCTGTGAAGAATAATGG + Intergenic
1024946740 7:54815525-54815547 CCTAATTCTGCGAAGAATGATGG + Intergenic
1025291757 7:57732177-57732199 TGTAATCCTGGAAGGAATCATGG - Intergenic
1025763925 7:64423498-64423520 TCTAATTCTGTAAAAAATAATGG - Intergenic
1025773272 7:64533636-64533658 TCTAATTCTGTGAAGAATTATGG - Intronic
1027295803 7:76768672-76768694 TCTAACTCTGTGAAGAATGATGG - Intergenic
1027328597 7:77067221-77067243 TCTAACTCTGTGAAGAATGATGG + Intergenic
1027349980 7:77301708-77301730 TCTAACTCTGTGAAGAATGATGG + Intronic
1027449517 7:78314683-78314705 TATAATTGAGCAAAGAATGATGG - Intronic
1027650550 7:80862560-80862582 TCTAATTATGTGAAGAATGATGG - Intronic
1028008646 7:85612268-85612290 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1028046331 7:86124789-86124811 TGTCATCCTTCAAATAATGAAGG - Intergenic
1028262035 7:88678442-88678464 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1028502247 7:91532095-91532117 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1028506453 7:91576181-91576203 TCTAATTCTGTGAAGAATGATGG + Intergenic
1028529289 7:91820509-91820531 TCTAGTTCTGTGAAGAATGATGG + Intronic
1028808211 7:95053656-95053678 CCTAATCCTGAAGAGAAGGATGG + Intronic
1028818679 7:95179994-95180016 CCTAATTCTGTGAAGAATGATGG - Intronic
1028961845 7:96757674-96757696 TCTAATTCTGTGAAGAATGATGG + Intergenic
1029000166 7:97144827-97144849 TGTAATTCTGTGAAGAATGATGG + Intronic
1029053536 7:97715651-97715673 TCTAATCCTGTGAAGAATGATGG - Intergenic
1029787168 7:102804152-102804174 TCTAACTCTGTGAAGAATGATGG - Intronic
1030013372 7:105193555-105193577 TCTAGTTCTGTGAAGAATGACGG + Intronic
1030326125 7:108220316-108220338 TCTAATTCTGTAAAGAATAATGG - Intronic
1030950601 7:115786636-115786658 AATAATGCTGCAATGAATGAAGG + Intergenic
1031232044 7:119120247-119120269 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1031234776 7:119160711-119160733 TCTAATTCTGTGAAGAATGATGG + Intergenic
1031376922 7:121037658-121037680 TCTAGTTCTGTGAAGAATGATGG + Intronic
1031549672 7:123093015-123093037 TCAACTGTTGCAAAGAATGAAGG + Intergenic
1031740355 7:125421994-125422016 TCTAATTCTCCGAAGAATGAAGG - Intergenic
1031879592 7:127181465-127181487 TCTAATTCTGTGAAGAATGATGG - Intronic
1032290417 7:130584937-130584959 TCTAATTCTGTGAAGAATGATGG - Intronic
1032604917 7:133339531-133339553 TCTAGTTCTGTGAAGAATGATGG + Intronic
1033027197 7:137786587-137786609 TCTAGTTCTGTGAAGAATGATGG - Intronic
1033260083 7:139836286-139836308 TCTAATTCTGTGAAGAATGATGG - Intronic
1033268130 7:139904468-139904490 TCTAATTCTGTGAAGAATGATGG + Intronic
1033530704 7:142260595-142260617 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1033623306 7:143082515-143082537 TCTAGTTCTGTGAAGAATGACGG - Intergenic
1033623691 7:143087388-143087410 TCTAATTCTGTAAAGAATGGTGG - Intergenic
1033721731 7:144066954-144066976 TCTAATTCTGTGAAAAATGATGG - Intergenic
1034376752 7:150651979-150652001 TCTAATCTTGTGAAGAATGATGG + Intergenic
1035069671 7:156133259-156133281 TCTAGTTCTGCGAAGAATGATGG - Intergenic
1036651215 8:10645367-10645389 TCAAATTTTGGAAAGAATGAGGG + Intronic
1037135984 8:15461050-15461072 TCTAATTCTGTGAAGAATGATGG + Intronic
1037320454 8:17636637-17636659 TCTAGTTCTGTGAAGAATGATGG + Intronic
1037560382 8:20068408-20068430 TCTAATTCTGTGACGAATGATGG - Intergenic
1038237444 8:25773654-25773676 TCTAATTCTGTGAAGAGTGATGG - Intergenic
1038366866 8:26945150-26945172 TCTAATTCTGTCAAGAATGTTGG + Intergenic
1039082921 8:33751177-33751199 CCTAATTCTGTGAAGAATGATGG + Intergenic
1039123960 8:34179819-34179841 TCTAATTCTGTGAAAAATGATGG - Intergenic
1039268749 8:35857241-35857263 TCTAATTCTGTGAAGAACGATGG - Intergenic
1039636104 8:39167564-39167586 TCTAATTCTGTGAAGAATGATGG + Intronic
1039710044 8:40046566-40046588 TCTAATTCTGTGAAGAATGATGG - Intergenic
1039728049 8:40242889-40242911 TCTAATTCTGTGAAGAATGATGG - Intergenic
1039810146 8:41039854-41039876 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1040442455 8:47458105-47458127 TCTAGTTCTGTGAAGAATGATGG + Intronic
1040635302 8:49266341-49266363 TCTAATTCTGTGAAGAATGATGG + Intergenic
1040711374 8:50193171-50193193 TCTAATTCTGTGTAGAATGATGG + Intronic
1040843790 8:51813839-51813861 TCTAATTCTGTGAAGAATGATGG - Intergenic
1041112384 8:54496079-54496101 TCTAATTCTGTGAAGAATGTTGG + Intergenic
1041228135 8:55720963-55720985 TCTAATTCTGTGAAGAATGATGG - Intronic
1041293318 8:56329029-56329051 TCTAATTCTGTGAAAAATGATGG + Intergenic
1041364255 8:57084049-57084071 TCTAATTCTGTGAAGAATGATGG - Intergenic
1041638151 8:60166873-60166895 TCTAATTCTGTGAAGAAGGATGG - Intergenic
1042088980 8:65138072-65138094 TCTAATTTTGTGAAGAATGATGG - Intergenic
1042160940 8:65894563-65894585 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1042616627 8:70656702-70656724 TCTAATTCTGTGAAGAATGATGG + Intronic
1043071289 8:75639115-75639137 TCTAATTCTGTGAAGAATGATGG + Intergenic
1043121305 8:76328469-76328491 CCTAATTCTGTGAAGAATGATGG + Intergenic
1043261288 8:78201894-78201916 TCTAACTCTGTGAAGAATGATGG - Intergenic
1043537395 8:81221044-81221066 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1043568450 8:81573472-81573494 TCAAATTCTGTGAAGAATGATGG + Intergenic
1043611019 8:82063771-82063793 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1043628103 8:82289851-82289873 TCTAATTCTGTGAAGACTGATGG + Intergenic
1043988251 8:86719615-86719637 TCTAGTTCTGTGAAGAATGATGG - Intronic
1044036102 8:87305375-87305397 TCTAATTCTCTGAAGAATGATGG - Intronic
1044343598 8:91076428-91076450 TCTAATGAAGCAAAGCATGAAGG + Intronic
1044787879 8:95814923-95814945 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1044883723 8:96752154-96752176 TCTAATTCTGTGAAGAATGTCGG + Intronic
1044947519 8:97403886-97403908 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1045095316 8:98791439-98791461 TCTAATTCTGTGAAGAATGATGG - Intronic
1046075769 8:109310095-109310117 TCTAATTCTGTGAAGAATGGTGG - Intronic
1046467523 8:114625749-114625771 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1046498594 8:115045842-115045864 TCTAATTCTGTGAAGAATGATGG - Intergenic
1046639857 8:116717368-116717390 TCTAGTTCTGTGAAGAATGATGG - Intronic
1046937380 8:119897633-119897655 TCTATTCCTACAAAGAAAGTGGG - Intronic
1047332122 8:123900017-123900039 TCTAATGCTGTGAAGAATGATGG + Intronic
1047558490 8:125960410-125960432 TTTAATTCTGTGAAGAATGATGG + Intergenic
1048530680 8:135246647-135246669 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1049770438 8:144378025-144378047 TCTCTTCCTGCAGAGACTGAGGG + Intronic
1049869208 8:144960105-144960127 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1050147753 9:2587839-2587861 TCTAACTCTGTGAAGAATGATGG - Intergenic
1050400658 9:5249873-5249895 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1050503181 9:6320109-6320131 TCTAATTCTGTGAAGAATGATGG - Intergenic
1050635875 9:7612226-7612248 CCTAATTCTGTGAAGAATGATGG + Intergenic
1050657412 9:7844307-7844329 TCTAATTTTGCAAAAAATTATGG - Intronic
1050988135 9:12109020-12109042 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1050999129 9:12258453-12258475 TCTAATTCTGTGAAGAAAGATGG + Intergenic
1051190278 9:14504350-14504372 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1051277507 9:15411264-15411286 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1051601000 9:18873818-18873840 TCTAATTCTGTGAAGAATGATGG + Intronic
1051700590 9:19818816-19818838 TCTAATTCTGTGAAGAATGATGG - Intergenic
1051885350 9:21886960-21886982 TCTAGTTCTGTGAAGAATGATGG + Intronic
1051893129 9:21963658-21963680 TCTAATTCTGTGAAGAATGATGG + Intronic
1052107360 9:24535724-24535746 TCTAGTTCTTTAAAGAATGATGG + Intergenic
1052219358 9:26000327-26000349 TCTAGTGCTGTGAAGAATGATGG - Intergenic
1052247341 9:26351913-26351935 TCTAATTCTGTGAAGAATGATGG - Intergenic
1052346938 9:27419275-27419297 TCTAATTATGTGAAGAATGATGG - Intronic
1052469079 9:28870063-28870085 ACAAATCCTTCAAAGAGTGAAGG - Intergenic
1052514255 9:29459937-29459959 TCTAATTCTGTGAAGAATGATGG + Intergenic
1052564939 9:30137621-30137643 TCTATTTCTGAAAAGAATGATGG - Intergenic
1052624541 9:30958223-30958245 TCTAATTCCGTGAAGAATGATGG + Intergenic
1052638470 9:31133015-31133037 TCTAACTCTGTGAAGAATGATGG - Intergenic
1052708671 9:32024630-32024652 TCTAATTCTGTGAAGACTGATGG + Intergenic
1052951239 9:34214139-34214161 TCTAATTCTGTGAAGAATGATGG - Intronic
1053471611 9:38350178-38350200 TCTAATTCTGTGAAGAATGATGG + Intergenic
1053884651 9:42635081-42635103 TGTAATTCTGTGAAGAATGACGG - Intergenic
1053888009 9:42659140-42659162 TGTAATTCTGTGAAGAATGACGG + Intergenic
1054223673 9:62442532-62442554 TGTAATTCTGTGAAGAATGACGG - Intergenic
1054227030 9:62466590-62466612 TGTAATTCTGTGAAGAATGACGG + Intergenic
1054351278 9:64018499-64018521 TGTAATTCTGTGAAGAATGATGG + Intergenic
1055106686 9:72520950-72520972 TCTATTCCTGTAACTAATGAAGG - Intergenic
1055181800 9:73397258-73397280 TCTAGTCCTATGAAGAATGATGG + Intergenic
1055317340 9:75047323-75047345 TCTAATGCCGCAAAGGCTGAGGG + Intergenic
1055335124 9:75225853-75225875 TCTATTTCTGTGAAGAATGATGG + Intergenic
1055345954 9:75339088-75339110 CCTAATTCTATAAAGAATGATGG + Intergenic
1055638919 9:78304268-78304290 GCTAATCCTGCAACCAATGGTGG - Intronic
1055656765 9:78458207-78458229 TCTAATTCTGTGAAGAATGGTGG - Intergenic
1055905429 9:81288286-81288308 TCTAATTCTGTAAAGAATGATGG + Intergenic
1055911237 9:81354683-81354705 TCTAATTCTGTGAAGAATGATGG - Intergenic
1056133365 9:83607164-83607186 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1056322350 9:85447848-85447870 TCTAATCCTGTGAAGAATGATGG + Intergenic
1056696549 9:88860470-88860492 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1056698660 9:88882768-88882790 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1056948482 9:91022259-91022281 TCTAGTTCTGTAAAGAATGACGG - Intergenic
1057476084 9:95403651-95403673 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1058084659 9:100735616-100735638 TGTAATTCTGTGAAGAATGATGG + Intergenic
1058156348 9:101520234-101520256 TCTAATTCTGTGAAGAATGATGG + Intronic
1058308034 9:103467250-103467272 TCTAACTCTGTGAAGAATGATGG + Intergenic
1058396504 9:104559538-104559560 TCTAGTCCTTTTAAGAATGATGG - Intergenic
1058540280 9:106004814-106004836 TCTAATTCTTTGAAGAATGATGG + Intergenic
1058558339 9:106195805-106195827 TCTAATTCTGCAAAAAATGATGG + Intergenic
1058622812 9:106901438-106901460 TCTAATTCTGTGAAGAATGATGG + Intronic
1058631198 9:106988560-106988582 TCTAATTCTGTGAAGCATGATGG + Intronic
1058775590 9:108280137-108280159 AATAATCCTGCAAAGGATGATGG + Intergenic
1059021916 9:110585069-110585091 TCTAATTCTGTGAAGGATGATGG + Intergenic
1059075058 9:111184185-111184207 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1060182252 9:121542331-121542353 ACTAATGCTGCTATGAATGATGG - Intergenic
1060310882 9:122460634-122460656 TTTAGTTCTGTAAAGAATGATGG + Intergenic
1061619648 9:131803587-131803609 TCAAAACTTCCAAAGAATGAGGG + Intergenic
1203697402 Un_GL000214v1:111859-111881 TGTAATTCTGTGAAGAATGATGG - Intergenic
1203551805 Un_KI270743v1:169153-169175 TGTAATTCTGTGAAGAATGATGG + Intergenic
1203618612 Un_KI270749v1:95823-95845 TCTAATTCTGTGAAGAATGATGG - Intergenic
1187218784 X:17303326-17303348 TCTAATTCTGTGAAGAATGATGG + Intergenic
1187430681 X:19221643-19221665 TGTAATTCTGTGAAGAATGATGG + Intergenic
1187636449 X:21234353-21234375 TCTAATTCTGTGAAGAATCATGG + Intergenic
1187681767 X:21774779-21774801 TCAAATTCTGTGAAGAATGATGG - Intergenic
1187749138 X:22442595-22442617 TCTAATTCTGTGAAGAATGATGG - Intergenic
1187796530 X:23009791-23009813 TCTAATGCTACAAAGGATGCAGG + Intergenic
1187849061 X:23573147-23573169 TCTAATTCTCTGAAGAATGATGG - Intergenic
1188045508 X:25421878-25421900 TCTAATTCTGTGAAGAATGATGG + Intergenic
1188799432 X:34509149-34509171 TCTAATTCTGTGAAGAATGATGG - Intergenic
1189218539 X:39349246-39349268 TCTAATTATGCGAAGAATGATGG - Intergenic
1189414093 X:40799349-40799371 TCTAACTCTGTGAAGAATGATGG - Intergenic
1189604170 X:42658862-42658884 TCTAATTCGGTGAAGAATGATGG - Intergenic
1189638966 X:43046560-43046582 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1189878770 X:45467006-45467028 TCTAATTCTGTGAAGAATGATGG + Intergenic
1189932128 X:46023992-46024014 TCTAATTCTGTGAAGAATAATGG - Intergenic
1189962469 X:46337480-46337502 TCTAATTCTGTGAAGAATAATGG - Intergenic
1190279913 X:48922776-48922798 TCTCATCTTGGAAGGAATGAGGG + Exonic
1190428630 X:50356414-50356436 TCTAGTCCTGTGAAGAATGATGG + Intergenic
1190449315 X:50562341-50562363 TCTAATTCTGTGAAGAATGATGG - Intergenic
1190472862 X:50800301-50800323 TCTAAACCAGCAAACCATGATGG + Intronic
1190631809 X:52394616-52394638 TCTAATTCTGTGAAGCATGATGG + Intergenic
1191037761 X:56045420-56045442 TCTAGTTCTGTAAAGAATGATGG + Intergenic
1191065848 X:56346899-56346921 TCTAATTCTGTGAAGAATGATGG - Intergenic
1191067346 X:56363975-56363997 TCTAATTCTGTGCAGAATGATGG + Intergenic
1191143980 X:57146088-57146110 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1191150592 X:57217803-57217825 TCTAATGCTGTGAAGAATGATGG + Intergenic
1191629343 X:63304440-63304462 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1191806658 X:65143024-65143046 TCTAATTCTGTGAAGAATAATGG + Intergenic
1191816311 X:65249577-65249599 TCTAAGTCTGTGAAGAATGACGG + Intergenic
1191891937 X:65952873-65952895 TCTAATTCTGTGAAGAATGATGG + Intergenic
1191913372 X:66175529-66175551 TCCAATTCTGTGAAGAATGATGG + Intronic
1191954546 X:66629809-66629831 TGTAATTCTGTGAAGAATGATGG - Intronic
1191964783 X:66745964-66745986 TCTAATTCTGTGAAGAATGATGG + Intergenic
1192068734 X:67914563-67914585 CCTAATTCTGTGAAGAATGATGG + Intergenic
1192164324 X:68817183-68817205 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1192531077 X:71886435-71886457 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1192610450 X:72561165-72561187 TCTATTTCTGTGAAGAATGATGG - Intronic
1192629589 X:72766659-72766681 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1192652121 X:72954145-72954167 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1192686774 X:73315305-73315327 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1192880728 X:75280793-75280815 TCTAATTCTGTGAAGAATGATGG + Intronic
1192967897 X:76199149-76199171 TCTAATTCTGTGAAGAATGATGG + Intergenic
1192987270 X:76413545-76413567 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1192991531 X:76463398-76463420 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1192994733 X:76500878-76500900 TCTAATTCTGTGAAGAATGATGG + Intergenic
1193077316 X:77368410-77368432 TCTAACTCTGTGAAGAATGATGG - Intergenic
1193078320 X:77379453-77379475 TCTAATTCTGTGAAGAATGATGG - Intergenic
1193155138 X:78164092-78164114 TCTAACTCTGTGAAGAATGATGG - Intergenic
1193220922 X:78925353-78925375 TCTAATTCTATGAAGAATGATGG - Intergenic
1193366638 X:80642181-80642203 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1193423405 X:81311921-81311943 TTTAATTCTGTGAAGAATGAGGG + Intergenic
1193575606 X:83192030-83192052 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1193590002 X:83377255-83377277 TCCAATTCTGTGAAGAATGATGG + Intergenic
1193775623 X:85637702-85637724 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1193791990 X:85826045-85826067 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1193826117 X:86229489-86229511 TCTAACTCTGTGAAGAATGATGG + Intronic
1193930966 X:87551468-87551490 TCTAATTCTGTAAAGAATGATGG - Intronic
1193937885 X:87644524-87644546 TCTAATTCTGTGAAGAATAATGG - Intronic
1193938037 X:87646363-87646385 TCTAATTCTGTGAAGAATGCTGG - Intronic
1193989576 X:88289775-88289797 TCTAGTTCTGTCAAGAATGATGG - Intergenic
1194035757 X:88869328-88869350 TCTCTCCCTGGAAAGAATGATGG - Intergenic
1194094952 X:89627820-89627842 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1194104234 X:89748662-89748684 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1194113633 X:89869548-89869570 TCTAATTGTGTTAAGAATGATGG + Intergenic
1194319328 X:92424009-92424031 TCTAGTTCTGTGAAGAATGAGGG + Intronic
1194412098 X:93569895-93569917 TCTAATTTTGTGAAGAATGATGG + Intergenic
1194533894 X:95082352-95082374 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1194543101 X:95199315-95199337 TCTAATTCTGTGAAGAATTATGG + Intergenic
1194601700 X:95929187-95929209 TCTAGTTCTGTAAAGAATTATGG - Intergenic
1194881519 X:99257588-99257610 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1194882209 X:99267870-99267892 TCTATTTCTGTGAAGAATGATGG + Intergenic
1194907135 X:99592154-99592176 TCTAGTTCTGTGAAGAATGACGG - Intergenic
1194926294 X:99828926-99828948 TCTAATTCTGTGAAGAGTGATGG + Intergenic
1194955997 X:100181291-100181313 TCTAATTCTGTGAAGAATGATGG - Intergenic
1194969060 X:100322618-100322640 TCTAATCCTGCAAAGAATGATGG + Intronic
1195015702 X:100778114-100778136 TCCAATTCTGTGAAGAATGATGG + Intergenic
1195019022 X:100807721-100807743 TCTAATTCTGTGAAGAATGATGG + Intergenic
1195629986 X:107045091-107045113 TATATTCCTGAAAAGAAGGATGG - Intergenic
1195796143 X:108649375-108649397 TCTAATTCTGTGAAGAATGACGG - Intronic
1195855147 X:109323522-109323544 TCTAATTCTGTGAATAATGATGG + Intergenic
1195913033 X:109907959-109907981 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1195972391 X:110487375-110487397 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1196204818 X:112927461-112927483 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1196218224 X:113080765-113080787 TCTGGTTCTGCGAAGAATGATGG - Intergenic
1196219265 X:113092516-113092538 TCTAATTCTGTGAAGAATGATGG - Intergenic
1196224808 X:113153777-113153799 TCTAATTCTGTGAAGAATGGTGG + Intergenic
1196323551 X:114372723-114372745 TGTAATCCTGCAGATAAAGAAGG + Intergenic
1196518999 X:116650478-116650500 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1196529914 X:116774029-116774051 TCTACTTCTGTGAAGAATGATGG - Intergenic
1196590166 X:117477962-117477984 TCTAACTCTGTGAAGAATGATGG + Intergenic
1196675315 X:118414197-118414219 TCTAATTCTGTGAAGAATGATGG + Intronic
1196737961 X:118997088-118997110 TCTAATTCTATGAAGAATGATGG - Intronic
1197054621 X:122101966-122101988 TCTAGTCCTGTGAAGAATGATGG - Intergenic
1197109932 X:122760651-122760673 TCTAGTTCTGTGAAGAATGACGG - Intergenic
1197475947 X:126925486-126925508 TCTGATTCTGTGAAGAATGATGG + Intergenic
1197519292 X:127477337-127477359 TCTAATTCTGTGAAGAATGATGG - Intergenic
1197545674 X:127820848-127820870 TCTAGTTCTGTAAAGAATGATGG - Intergenic
1197589259 X:128388406-128388428 TCTAATTCTGTGAAGAATGATGG - Intergenic
1197591293 X:128413959-128413981 TCTAGTTCTGTGAAGAATGATGG + Intergenic
1197664237 X:129206223-129206245 TCTAATTCTGTGAAGAATGATGG + Intergenic
1197671124 X:129278973-129278995 TCTAATTCTGTGAACAATGATGG + Intergenic
1197954070 X:131928039-131928061 TCTAATTCTGTGAAGAATGGTGG - Intergenic
1197956400 X:131953703-131953725 TCTAATCCTGTGAAGAATGATGG + Intergenic
1198044716 X:132889775-132889797 TCTAGTTCTGTAAAGAATGATGG - Intronic
1198510666 X:137348152-137348174 TCTAATTCTGTGAAGAATGATGG - Intergenic
1198557755 X:137813921-137813943 TCAGATCATGCAAAGAATAAAGG + Intergenic
1198559526 X:137833769-137833791 TCTAGTTCTGTGAAGAATGAAGG + Intergenic
1198569084 X:137936005-137936027 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1198583262 X:138090887-138090909 TCTAATTCTGTGAAAAATGATGG - Intergenic
1198604132 X:138317930-138317952 TCTAGTTCTGCGGAGAATGATGG + Intergenic
1198616875 X:138467817-138467839 TCTAATTCTGTGAAGAATGATGG - Intergenic
1198665108 X:139012313-139012335 TCTAGTTCTGTGAAGAATGACGG - Intronic
1198668774 X:139054596-139054618 TCTAGTTCTGTGAAGAATGATGG + Intronic
1198690120 X:139273518-139273540 AATAATGCTGCAAAGAATGTGGG - Intergenic
1198695852 X:139336801-139336823 TCTAGTACTGTGAAGAATGATGG + Intergenic
1198843294 X:140881583-140881605 TCTAATTCTGTGAAGAATGATGG - Intergenic
1199007956 X:142724373-142724395 TCTAATTCTGTGAAGAATGATGG - Intergenic
1199206265 X:145152368-145152390 TCTAGTTCTGTGAAGAATGATGG - Intergenic
1199521126 X:148737138-148737160 TCTAATTCTGTGAAGCATGATGG + Intronic
1199668924 X:150125464-150125486 TATAATTCTGTGAAGAATGATGG - Intergenic
1199821340 X:151451410-151451432 TCTAATTCTGTGAAGAATGATGG + Intergenic
1200466313 Y:3524587-3524609 TCTAATTGTGTTAAGAATGATGG + Intergenic
1200627459 Y:5537084-5537106 TCTAGTTCTGTGAAGAATGAGGG + Intronic
1201153079 Y:11104755-11104777 TGTAATTCTGTGAAGAATGATGG + Intergenic
1201316141 Y:12648000-12648022 TCTAATTCTGAGAAGAATGATGG - Intergenic
1202036037 Y:20636760-20636782 TCTAACTCTGTGAAGAATGATGG + Intergenic
1202043985 Y:20718539-20718561 TCTAATTCTGTGAAGAATGATGG - Intergenic