ID: 1194970764

View in Genome Browser
Species Human (GRCh38)
Location X:100341081-100341103
Sequence CAGAATGTTTAGATGGACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 296}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194970764_1194970768 13 Left 1194970764 X:100341081-100341103 CCCAAGTCCATCTAAACATTCTG 0: 1
1: 0
2: 0
3: 19
4: 296
Right 1194970768 X:100341117-100341139 CTGCTAATGTTTTTATACCCTGG 0: 1
1: 0
2: 0
3: 7
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194970764 Original CRISPR CAGAATGTTTAGATGGACTT GGG (reversed) Intronic
901952056 1:12757183-12757205 CAGAACATTTAGATAGCCTTTGG + Intronic
902200182 1:14827431-14827453 AAGAATGATATGATGGACTTTGG - Intronic
907830898 1:58063244-58063266 CAGAATGTTAAAATGGCCTTGGG + Intronic
908174601 1:61542107-61542129 AAGAATGATAAAATGGACTTTGG - Intergenic
909406752 1:75298962-75298984 CAGCATTTTTTGATGGTCTTGGG - Intronic
909785052 1:79600727-79600749 CAGAATGTCTAGATGGGTTGAGG + Intergenic
910387225 1:86698145-86698167 AAAAATGTTTCAATGGACTTTGG - Intergenic
912407178 1:109449995-109450017 GAGAAAATTTAGATGGCCTTCGG + Intergenic
912941930 1:114052813-114052835 AAGAATGATAAAATGGACTTTGG - Intergenic
914935824 1:151979344-151979366 TAGATTGTTTAGATGTACATGGG - Intergenic
915750928 1:158210014-158210036 AAGAATGATATGATGGACTTTGG - Intergenic
916023023 1:160810746-160810768 AATAATATTTAGATGGATTTTGG - Intronic
916351756 1:163857851-163857873 CATAATGTTTAATTAGACTTTGG + Intergenic
916902783 1:169247659-169247681 CAGAATTCTATGATGGACTTTGG - Intronic
917079715 1:171245104-171245126 AAGAATGATACGATGGACTTTGG + Intergenic
918529732 1:185504923-185504945 AAGAATGATAAAATGGACTTTGG - Intergenic
919072934 1:192778528-192778550 AAGAATGATACGATGGACTTTGG - Intergenic
922417255 1:225432772-225432794 GAGAATGTTTAAATAGGCTTGGG - Intergenic
922794116 1:228330911-228330933 AAGAATGTTTCAGTGGACTTTGG - Intronic
922995457 1:229954813-229954835 AAGAATGTTACAATGGACTTTGG - Intergenic
924089393 1:240486854-240486876 CAGAGTGATTATAAGGACTTTGG + Intergenic
924659104 1:246000393-246000415 CAGAATGTGAAGATGGAGATAGG + Intronic
1063842293 10:10086009-10086031 AAGAATGATACGATGGACTTTGG - Intergenic
1064921089 10:20519139-20519161 AAGAATGATAAAATGGACTTTGG - Intergenic
1068566674 10:58583389-58583411 AAGAATGTTATAATGGACTTTGG - Intronic
1070971816 10:80573335-80573357 CAGTATGTTCAGATGTACATAGG + Intronic
1072428663 10:95351995-95352017 CACAATTTTTAGAAGGCCTTAGG + Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1078996991 11:16711891-16711913 AAGAATGATATGATGGACTTCGG - Intronic
1082721755 11:56686396-56686418 AAGAATGATATGATGGACTTTGG + Intergenic
1082921927 11:58505029-58505051 AAGAATGATAAAATGGACTTTGG + Intergenic
1087105945 11:94406906-94406928 AAGAATGATACGATGGACTTTGG - Intergenic
1089512721 11:119010599-119010621 CAAAATGTTTACAAGGACTCTGG + Intronic
1089819908 11:121215526-121215548 AAGAATGATTTAATGGACTTTGG + Intergenic
1090201217 11:124858143-124858165 CTTAATGTTTAGATGTTCTTTGG - Intergenic
1090551694 11:127826808-127826830 GACAATGTTTACATGGACTGGGG - Intergenic
1090757829 11:129809674-129809696 CAGAATGATACCATGGACTTTGG + Intergenic
1091862193 12:3795803-3795825 CAGAATCTATAGAGGCACTTAGG - Intronic
1092061282 12:5552878-5552900 CAGAATGATACGATGGACTTTGG + Intronic
1092158232 12:6298988-6299010 AAGAATGATATGATGGACTTTGG + Intergenic
1093011121 12:14108181-14108203 AAGAATGATATGATGGACTTTGG + Intergenic
1095472952 12:42555866-42555888 TAGAAGGTTTATATGCACTTGGG - Intronic
1096007032 12:48182049-48182071 CAGAATGTTTAAATAAACTAAGG - Intergenic
1097200791 12:57276901-57276923 AAGAATGATAAAATGGACTTTGG + Intronic
1097385376 12:58944439-58944461 AAGAATGATAAAATGGACTTTGG - Intergenic
1097462011 12:59873590-59873612 AAGAATGATAAAATGGACTTTGG + Intergenic
1098119496 12:67221064-67221086 CAGAGGGTTTAGAAGAACTTAGG + Intergenic
1098220987 12:68269735-68269757 CAGAATGTCTTCATGCACTTAGG + Intergenic
1098554738 12:71805262-71805284 CAGAGTGATATGATGGACTTTGG - Intergenic
1099857640 12:88187413-88187435 CATTATGTTTTGATGGACCTAGG + Intronic
1100290440 12:93208962-93208984 AAGAATGATAAAATGGACTTTGG - Intergenic
1103196429 12:119047508-119047530 AAGAATGATTCAATGGACTTTGG - Intronic
1104167892 12:126251569-126251591 AAGAATGATAAAATGGACTTTGG + Intergenic
1105597753 13:21855356-21855378 AAGAATGTTACAATGGACTTTGG - Intergenic
1107258014 13:38454206-38454228 CATAATTTTTATATGCACTTGGG + Intergenic
1109052571 13:57503527-57503549 AAGAATGATACGATGGACTTTGG - Intergenic
1109181128 13:59215237-59215259 CAGAATGATATAATGGACTTTGG - Intergenic
1109398973 13:61799513-61799535 CAGACTCTTTAGTTGGAGTTCGG - Intergenic
1109612587 13:64786497-64786519 CAGAGTGGTAAAATGGACTTAGG + Intergenic
1109914336 13:68961015-68961037 CAAAATGTTTGGTTGGTCTTTGG - Intergenic
1110505080 13:76276445-76276467 GAGAATGATAAAATGGACTTTGG + Intergenic
1111146425 13:84187103-84187125 CAGAGTGATTTAATGGACTTTGG - Intergenic
1111221705 13:85213420-85213442 CAGAATGTTTGGTTGGCCTCCGG + Intergenic
1111506860 13:89201952-89201974 CAGAATGTTTTGATCGAATGAGG - Intergenic
1114788624 14:25629803-25629825 GAGAATGTTTAGTTTGGCTTTGG + Intergenic
1114906574 14:27135584-27135606 CAGAATGTTATAATGGATTTTGG + Intergenic
1115410485 14:33068648-33068670 CAGAAGGTTAAGAAGGATTTAGG + Intronic
1115707218 14:36011611-36011633 AAGAATGATTCGATGAACTTTGG - Intergenic
1116593658 14:46812051-46812073 CAGAATGCTCATATGGACTTGGG + Intergenic
1117517971 14:56521396-56521418 CAGAGTGATAAAATGGACTTTGG - Intronic
1117798258 14:59416784-59416806 CAGAATCTCTAGGTGGACCTAGG - Intergenic
1118534832 14:66750164-66750186 AAGAATATTTAGATGACCTTGGG - Intronic
1118730169 14:68660459-68660481 CAGAATGTTTAGCTCCATTTTGG - Intronic
1119098953 14:71861953-71861975 AAGAATGATACGATGGACTTTGG + Intergenic
1120489938 14:85164777-85164799 AAGAATGATACGATGGACTTTGG + Intergenic
1120503149 14:85321985-85322007 CAGAATTTTTAGTTGGCCTCTGG - Intergenic
1121524755 14:94612091-94612113 GAGAATGTAAAGAAGGACTTTGG - Intronic
1124165855 15:27324986-27325008 CAGGTTGTTTCAATGGACTTTGG + Intronic
1124712346 15:32025262-32025284 TAGAATTTTTAGATCAACTTGGG - Intergenic
1124825272 15:33088026-33088048 CAGAATGATACAATGGACTTTGG + Intronic
1126494289 15:49273252-49273274 CAGATTTCTTAGATTGACTTTGG + Intronic
1127795925 15:62438276-62438298 CAGAATGTTTAAAGGGAGTGGGG + Intronic
1129643511 15:77408357-77408379 AAGAATGATAAAATGGACTTTGG + Intronic
1130700257 15:86172007-86172029 AAGAATGTTAAAATGGACTTTGG + Intronic
1130842323 15:87712529-87712551 CAGAATGGTTACATGCACTTTGG + Intergenic
1131414417 15:92241037-92241059 CAAAATGGTAAAATGGACTTTGG + Intergenic
1131606969 15:93916375-93916397 AAAAATGTTTACATGGATTTAGG + Intergenic
1133845776 16:9452383-9452405 AAGAATGATACGATGGACTTTGG - Intergenic
1135617255 16:23922101-23922123 CAGCATGTTTAGAAGGACATTGG + Intronic
1137998917 16:53253410-53253432 AAGAATGGTATGATGGACTTTGG + Intronic
1139372159 16:66475640-66475662 CAGAATTTTTGGAAGAACTTAGG - Exonic
1140659625 16:77175416-77175438 CAGAGTGATTTAATGGACTTTGG + Intergenic
1144383999 17:14731761-14731783 CACACTGGTTAGATGGCCTTGGG + Intergenic
1145823752 17:27860750-27860772 CACAATGTTTAGAATGACTAGGG + Intronic
1148643345 17:49204588-49204610 CAGAATGGTGAGATGGAGTCAGG + Intronic
1149399747 17:56283705-56283727 AAGAATGATTCAATGGACTTGGG + Intronic
1149835957 17:59912755-59912777 CAGAATGTTTTGAGCTACTTCGG + Exonic
1150063620 17:62090355-62090377 CAGACTGTTTGCATGTACTTTGG - Intergenic
1150242567 17:63647032-63647054 AAGAATGTTTAGAGGTACTAAGG - Intronic
1150537915 17:66063464-66063486 CAGAATGGTATAATGGACTTTGG + Intronic
1150911504 17:69392413-69392435 AATAATGATAAGATGGACTTTGG - Intergenic
1151112877 17:71700291-71700313 CTGAAAATTTAGATGGACCTGGG - Intergenic
1153325063 18:3810238-3810260 CAGAATGTTTAACTGACCTTAGG + Intronic
1155185821 18:23385751-23385773 CTGCATGTTTAGAGGAACTTGGG + Intronic
1155628938 18:27868607-27868629 AAGAATGATAAAATGGACTTTGG + Intergenic
1156081196 18:33338713-33338735 AAGAATGATTTGTTGGACTTTGG + Intronic
1156900756 18:42298087-42298109 AAGAATGTGGAGATGGGCTTGGG + Intergenic
1156926713 18:42589839-42589861 GAGAAAATTTAGATGGCCTTGGG - Intergenic
1157037477 18:43992492-43992514 GAGACTGTTTTGATGAACTTGGG + Intergenic
1157109222 18:44804275-44804297 GAGAATATGTAGATGGGCTTAGG + Intronic
1160248067 18:77176279-77176301 CAGAATGATACAATGGACTTTGG - Intergenic
1162942608 19:14022202-14022224 AAGAATCTTTAGATGGCCTTGGG - Intergenic
1164322523 19:24162679-24162701 CAGAGTCTTCAGATGGCCTTTGG - Intergenic
1164492558 19:28727929-28727951 CATGGTGTTTAGACGGACTTCGG + Intergenic
1164728282 19:30481842-30481864 AAGAATGATACGATGGACTTTGG - Intronic
1166428629 19:42702357-42702379 AAGAATGATACGATGGACTTGGG - Intronic
1166827366 19:45617739-45617761 GAGAATGTCCAGATGGACATGGG - Intronic
1168362125 19:55750549-55750571 AAGAATGATAAAATGGACTTTGG - Intergenic
924976270 2:178738-178760 AAGAATGATAAAATGGACTTTGG + Intergenic
925297442 2:2787244-2787266 CAGAATGTTTTGAAGGCCTAAGG - Intergenic
925665711 2:6253005-6253027 AAGAATGATATGATGGACTTTGG - Intergenic
927803181 2:26120404-26120426 CAGAATCTAAGGATGGACTTCGG - Intronic
928019399 2:27690328-27690350 CAGAGTGGTATGATGGACTTTGG - Intronic
928078089 2:28283515-28283537 CAGAATGTTCCAAGGGACTTGGG - Intronic
928686266 2:33753093-33753115 CAGGATCTTTAGCTGTACTTAGG + Intergenic
928915976 2:36470931-36470953 CAGAATATTAACATGGAGTTTGG + Intronic
930874655 2:56201331-56201353 TAGAACGTTTAGATTAACTTTGG + Intronic
932801991 2:74749016-74749038 CAGAATGTTTATATGCACTCTGG + Intergenic
933382192 2:81563147-81563169 AAGAATGATATGATGGACTTTGG + Intergenic
933904899 2:86882273-86882295 CAGAGTGTTATGATGGACTTTGG + Intergenic
934489454 2:94750387-94750409 AAGAATGATTTAATGGACTTTGG + Intergenic
936367329 2:111869889-111869911 CAGAGTGTTATGATGGACTTTGG - Intronic
936720368 2:115245018-115245040 AAGAATGATACGATGGACTTTGG - Intronic
938487491 2:131726311-131726333 CGGTATATTTAGATGTACTTTGG + Intronic
938700112 2:133869917-133869939 AAGAATGATATGATGGACTTTGG + Intergenic
938735737 2:134185105-134185127 AAGAATGATATGATGGACTTTGG + Intronic
940974682 2:159930050-159930072 AAGAATGATATGATGGACTTTGG + Intergenic
941554679 2:166962195-166962217 AAGACTGTTTAGATGACCTTTGG - Intronic
942906959 2:181194624-181194646 CAGACTGTGTAGATGGTCTGAGG - Intergenic
943654771 2:190496877-190496899 AAGAATGATATGATGGACTTTGG + Intronic
943868614 2:192962302-192962324 CAAAATATTAAGATGCACTTGGG + Intergenic
944191611 2:197009943-197009965 CAGTATGATTATATGGAATTGGG - Intronic
944921641 2:204420302-204420324 CACAATGGTTAGAAAGACTTTGG - Intergenic
945666286 2:212747837-212747859 CAGAAAGTTGAAAAGGACTTTGG + Intergenic
945874333 2:215262741-215262763 CAGTATGTTTTTATAGACTTTGG + Intergenic
945918004 2:215724966-215724988 AAGAATGATACGATGGACTTTGG - Intergenic
946032288 2:216714714-216714736 CAGAATGTTTATGTGGGCCTAGG + Intergenic
948531630 2:238611695-238611717 AAGAATGTTACAATGGACTTTGG + Intergenic
948532029 2:238615170-238615192 CAGGATGTGTAGAGGGTCTTTGG + Intergenic
1170788565 20:19489116-19489138 CTGAATGTATAGATTGAATTAGG - Intronic
1172230821 20:33334377-33334399 GAGGATGGTTAGATGGACTGTGG + Intergenic
1172826262 20:37789332-37789354 AAGGATGTTTGGATGGTCTTTGG + Intronic
1177209838 21:18057438-18057460 CAGAATGTTGATATGGAATGAGG - Intronic
1178405465 21:32319603-32319625 CTGAATTTTTGGAGGGACTTAGG - Intronic
1181770208 22:25119743-25119765 CAGAAAGTTTGGAGGGACATTGG + Intronic
1183602519 22:38848221-38848243 GAGAATGATTAGATGGACAGGGG - Intergenic
949267220 3:2172368-2172390 AAGAATGATTTAATGGACTTTGG + Intronic
949321524 3:2816394-2816416 AAGAATGATACGATGGACTTTGG + Intronic
951151576 3:19296661-19296683 AAGAATGATACGATGGACTTTGG + Intronic
951269750 3:20609286-20609308 AAGAATGATTCAATGGACTTTGG + Intergenic
951468274 3:23026520-23026542 AAGAATGATAAAATGGACTTTGG + Intergenic
951800245 3:26587847-26587869 CAGAATGTTTTGCTGAACTGTGG - Intergenic
952083232 3:29786262-29786284 CTGAATTTTTACATGGCCTTTGG - Intronic
952732967 3:36659139-36659161 AAGAATGATTCAATGGACTTTGG + Intergenic
955088533 3:55726715-55726737 CAGAATGTTTACCTAGACATGGG + Intronic
955136239 3:56221574-56221596 CAGGATGTTTACATGGAGGTAGG - Intronic
955561701 3:60198296-60198318 CACAATTTTTATATGCACTTAGG - Intronic
955663207 3:61323606-61323628 AAGAATGATATGATGGACTTTGG + Intergenic
955802330 3:62699138-62699160 GAGAATGATACGATGGACTTTGG - Intronic
956087715 3:65630677-65630699 CAGAGTGATTTAATGGACTTTGG + Intronic
956710181 3:72032261-72032283 CATATTGTTTAGTTTGACTTAGG - Intergenic
957772562 3:84713368-84713390 CAGAATGATACAATGGACTTTGG + Intergenic
957953958 3:87160257-87160279 CAGCATGTTGAGATGAAATTGGG - Intergenic
958444532 3:94198800-94198822 CTGAATGTGTAGATGGCTTTTGG + Intergenic
958606716 3:96367322-96367344 AAGAATGATTCAATGGACTTTGG - Intergenic
959731105 3:109603620-109603642 AAGAATGATACGATGGACTTTGG + Intergenic
959911573 3:111769332-111769354 GAGAATATTTACTTGGACTTTGG - Intronic
961159575 3:124712016-124712038 AAGAATGATATGATGGACTTTGG + Intronic
963699626 3:148608087-148608109 AAGAATGATACGATGGACTTTGG - Intergenic
964115113 3:153128319-153128341 AAGAATGATAAAATGGACTTTGG - Intergenic
965130790 3:164697429-164697451 CAGAGTGGTATGATGGACTTTGG - Intergenic
966578322 3:181528995-181529017 AAGAATGATAAGATGGACTTTGG + Intergenic
968283577 3:197495091-197495113 AAGAGTCTTTAGATGGACTTGGG + Intergenic
969196981 4:5570961-5570983 AAGAATGATAAAATGGACTTTGG + Intronic
969424867 4:7118279-7118301 AGGAATGTTTAGATGGACGGTGG + Intergenic
971594139 4:28507075-28507097 TAGAATGTCTAGATGACCTTTGG + Intergenic
975554493 4:75647866-75647888 AAGAATGTTTAGATTGCTTTGGG - Intronic
975616152 4:76249715-76249737 AAGAATGATAAAATGGACTTTGG - Intronic
975901374 4:79157276-79157298 CAGAATGATACAATGGACTTTGG - Intergenic
976114135 4:81708867-81708889 CAGAATGGTATAATGGACTTTGG + Intronic
977655339 4:99515068-99515090 AAGAATGTTATAATGGACTTAGG + Intronic
977849561 4:101809313-101809335 AAGAATGATATGATGGACTTTGG + Intronic
978345514 4:107764001-107764023 AAGAATGATACGATGGACTTTGG - Intergenic
978810101 4:112840202-112840224 CAGAATCTTGGGATGGACTTAGG + Intronic
978872625 4:113598451-113598473 GAGAATATTTAGATGATCTTGGG + Intronic
981894169 4:149777714-149777736 CAGAGTTTTTAGTTGTACTTCGG - Intergenic
982068950 4:151678485-151678507 CAGGAAGTTTAGATGGCCTGAGG - Intronic
983931359 4:173456337-173456359 CTGAATGTTAAGATATACTTTGG - Intergenic
984273910 4:177584175-177584197 CAGAATGGTGAGATTGACATAGG - Intergenic
984640016 4:182153528-182153550 CAGAATGAGAAAATGGACTTCGG - Intronic
985554285 5:548779-548801 CAGAATGTGAAGATGGATTAAGG - Intergenic
986490261 5:8282094-8282116 AAGAATGATAAGATGGACTTTGG + Intergenic
986549492 5:8936468-8936490 AAGAATGTTGAGCTGAACTTTGG + Intergenic
988173961 5:27696393-27696415 CAGAATGATACAATGGACTTTGG + Intergenic
988309859 5:29543180-29543202 CAGAAATTTTAGATAGAATTTGG - Intergenic
989178564 5:38554680-38554702 CAGAATGTTTACATGAGCATAGG + Intronic
989548789 5:42707523-42707545 CTGAATGTGTAGATTGGCTTGGG + Intronic
990348800 5:54895197-54895219 CACAAGGTCTATATGGACTTAGG + Intergenic
991001325 5:61786267-61786289 AAGAATGATACGATGGACTTTGG + Intergenic
991336101 5:65548980-65549002 CAGAAGGTTTCAATGTACTTTGG + Intronic
994330210 5:98496221-98496243 AAGAATGATAAAATGGACTTTGG + Intergenic
994686127 5:102954325-102954347 AAGAATGATAAAATGGACTTTGG - Intronic
994823689 5:104685013-104685035 AAGAATGATAAAATGGACTTTGG + Intergenic
995940865 5:117582273-117582295 AAGAATGATATGATGGACTTTGG - Intergenic
996096673 5:119406637-119406659 CAGAATGTTAAGACGGAATTTGG - Intergenic
996288469 5:121823636-121823658 AAGAATGATACGATGGACTTTGG - Intergenic
996310120 5:122095071-122095093 CAGAATTTTTCTATGCACTTGGG - Intergenic
997140960 5:131380282-131380304 AAGAATGATCAAATGGACTTGGG - Intronic
998603606 5:143610710-143610732 GAGAATGATACGATGGACTTTGG + Intergenic
999990193 5:157042642-157042664 CAGAGTCTTCAGATGGCCTTTGG - Exonic
1000400431 5:160821438-160821460 CTGAATGTGTAGATTGCCTTGGG - Intronic
1002763820 6:222577-222599 CACAATGATTAAATGGACATTGG + Intergenic
1008820054 6:55621190-55621212 CTGAATCTGTAGATGGCCTTGGG + Intergenic
1009164154 6:60320277-60320299 CAGTCTGTATAGAGGGACTTAGG + Intergenic
1009641547 6:66343533-66343555 CTGAAAGTTTAGCTGAACTTAGG + Intergenic
1010008388 6:71022244-71022266 CTTAATGTTTTGAGGGACTTAGG + Intergenic
1010015068 6:71095433-71095455 AAGAATGATTTAATGGACTTTGG - Intergenic
1012357045 6:98327506-98327528 AAGAATGATATGATGGACTTTGG - Intergenic
1013537828 6:111079242-111079264 AAGAATGATATGATGGACTTGGG - Intergenic
1015638018 6:135298653-135298675 CAAAAGCTTTAGATGAACTTGGG + Intronic
1015641452 6:135337890-135337912 TAGAATATTTGGATTGACTTTGG - Intronic
1016180603 6:141142988-141143010 CAGAATGATAGAATGGACTTTGG - Intergenic
1016192268 6:141284701-141284723 CTGAATGTGTAGATTGCCTTGGG + Intergenic
1016351264 6:143171214-143171236 AAGAATGATAAAATGGACTTTGG - Intronic
1016474501 6:144411559-144411581 CAGAATGTTTACCTCGATTTTGG - Intronic
1016822040 6:148356048-148356070 CAGAATGATACAATGGACTTTGG - Intronic
1016837163 6:148489535-148489557 TTGAATCTTTAGATTGACTTGGG + Intronic
1018436394 6:163763073-163763095 CAGAATGTTTACAAGTGCTTTGG + Intergenic
1018867486 6:167757689-167757711 TGGAATGTTTAGAGGGACGTTGG - Intergenic
1019092254 6:169548254-169548276 CTGAATGTGTAGATCGAATTGGG - Intronic
1021466496 7:20949968-20949990 CAGAATGATATAATGGACTTTGG + Intergenic
1022425481 7:30264898-30264920 AAGAATGATAAAATGGACTTTGG - Intergenic
1022759588 7:33333235-33333257 AAGAATGATGACATGGACTTTGG - Intronic
1023149790 7:37191583-37191605 GAGAATGTTTAGATAAATTTTGG + Intronic
1023308543 7:38857041-38857063 CACAATGGTTAGATGGACAGAGG + Intronic
1024160167 7:46665967-46665989 AAGAATGATAAAATGGACTTTGG - Intergenic
1024776685 7:52795862-52795884 CAGAATGATATAATGGACTTTGG + Intergenic
1024809791 7:53195283-53195305 CAAAATGTTTACATGGAATATGG + Intergenic
1024894077 7:54237002-54237024 CAGAATGATAAAATGGACTTTGG + Intergenic
1026632975 7:72053812-72053834 AAGAATGATACGATGGACTTTGG - Intronic
1027699705 7:81454734-81454756 AAGAATGATAAAATGGACTTTGG + Intergenic
1028784041 7:94772264-94772286 AAGAATGATTCAATGGACTTTGG + Intergenic
1031043326 7:116861721-116861743 AAGAATGATAAAATGGACTTTGG - Intronic
1032057492 7:128695509-128695531 AAAAATGTTCAGGTGGACTTGGG - Intergenic
1032819808 7:135513887-135513909 CAGAAGGTGTATATGGACTATGG + Intergenic
1032905772 7:136363132-136363154 CAAAATGATAAAATGGACTTTGG - Intergenic
1033890490 7:146006847-146006869 AAGAATGATACGATGGACTTTGG + Intergenic
1034403552 7:150884995-150885017 AAGAATGATATGATGGACTTTGG + Intergenic
1034594977 7:152181298-152181320 CAGTTTGTGTAGATGGTCTTGGG + Exonic
1035148640 7:156846612-156846634 CTGAATGTATAGATGAAGTTGGG - Intronic
1037478471 8:19280493-19280515 CAGAATGGTATAATGGACTTTGG - Intergenic
1037713287 8:21373120-21373142 CAGAATGATACAATGGACTTCGG - Intergenic
1038463516 8:27738080-27738102 AAGAATGATACGATGGACTTTGG + Intronic
1038684596 8:29704752-29704774 AAGAATGTTGTAATGGACTTTGG - Intergenic
1039000748 8:32977258-32977280 AAGAATGATACGATGGACTTTGG - Intergenic
1039007533 8:33056697-33056719 CAGAGTGTTGTAATGGACTTTGG + Intergenic
1039271951 8:35891843-35891865 CAGAATGGTTTGAAGGAGTTGGG + Intergenic
1040667195 8:49648732-49648754 CAAAATGTATATATTGACTTTGG - Intergenic
1041228252 8:55722640-55722662 AAGAATGATATGATGGACTTTGG + Intronic
1042514216 8:69642817-69642839 AAGAATGTTTAACTGCACTTTGG + Intronic
1042850648 8:73212867-73212889 CAGAAGTTGTAGATGGGCTTGGG - Intergenic
1043493555 8:80775025-80775047 CAGAGTTTTTAGTTTGACTTAGG + Intronic
1043537290 8:81219696-81219718 AAGAATGATATGATGGACTTTGG - Intergenic
1044166650 8:88992577-88992599 CAGAATGTATGGATGGTCTTGGG + Intergenic
1044177585 8:89148118-89148140 CAGAATGTTTAGAAGACATTAGG - Intergenic
1046234232 8:111401578-111401600 CATAAGGTTTAGATGGAATAAGG + Intergenic
1046246358 8:111567573-111567595 CTGAATTTTTATATTGACTTAGG + Intergenic
1046456673 8:114473956-114473978 CAGAGTGTTTACATGGACCTTGG + Intergenic
1046762898 8:118039899-118039921 CAAAATGCTTACATGGACTTAGG - Intronic
1051363173 9:16300396-16300418 CAGAATGATACAATGGACTTTGG + Intergenic
1052282226 9:26746445-26746467 CAGAATCTGTAGATGTGCTTTGG - Intergenic
1052581423 9:30359901-30359923 AAGAATGATGCGATGGACTTTGG - Intergenic
1052732814 9:32309654-32309676 CAGAATGATATAATGGACTTTGG + Intergenic
1053236422 9:36458885-36458907 CAGAATGTCTTGATGGTCTGTGG - Intronic
1053525069 9:38820837-38820859 CAGAATGTTATGATGAACATTGG - Intergenic
1054197300 9:62045259-62045281 CAGAATGTTATGATGAACATTGG - Intergenic
1054641109 9:67543423-67543445 CAGAATGTTATGATGAACATTGG + Intergenic
1055120256 9:72651930-72651952 AAGAATGTTACAATGGACTTTGG - Intronic
1055205689 9:73727748-73727770 TAGAAAGTGTTGATGGACTTAGG - Intergenic
1055866898 9:80825511-80825533 AAGAATGATATGATGGACTTTGG + Intergenic
1055969505 9:81897942-81897964 CAGAATGATATAATGGACTTTGG + Intergenic
1056700589 9:88903049-88903071 CACAATTTTTCCATGGACTTGGG + Intergenic
1058166060 9:101620546-101620568 CCAAATGTTTAAATGTACTTAGG - Intronic
1059814758 9:117900011-117900033 TAGAATCTATAGATGGAATTTGG - Intergenic
1062043185 9:134413542-134413564 CAGAATGGTTTGGTGGAGTTCGG + Intronic
1185692392 X:2166912-2166934 AAGAATGATATGATGGACTTTGG + Intergenic
1187553838 X:20332328-20332350 AAGAATGTTGAGTGGGACTTTGG - Intergenic
1187590633 X:20713587-20713609 TTAAATGTTTTGATGGACTTGGG + Intergenic
1189247607 X:39575790-39575812 CAGAATGCAAAGCTGGACTTGGG - Intergenic
1189905480 X:45754871-45754893 CAGAATGATACAATGGACTTTGG + Intergenic
1190894977 X:54608528-54608550 AAGAATGATACGATGGACTTTGG - Intergenic
1192394362 X:70763410-70763432 AAGAATGATATGATGGACTTTGG + Intronic
1192852771 X:74975327-74975349 AAGAATGATAAAATGGACTTTGG - Intergenic
1193007010 X:76631196-76631218 AAGAATGATAAAATGGACTTTGG - Intergenic
1193158093 X:78195925-78195947 AAGAATGATATGATGGACTTTGG + Intergenic
1193503108 X:82304651-82304673 AAGAATGATAAGATGGATTTTGG + Intergenic
1194199967 X:90942270-90942292 CAGAATGTAAAAGTGGACTTGGG + Intergenic
1194917979 X:99728103-99728125 AAGAATGATAAAATGGACTTTGG + Intergenic
1194956110 X:100182646-100182668 AAGAATGATACGATGGACTTTGG + Intergenic
1194970764 X:100341081-100341103 CAGAATGTTTAGATGGACTTGGG - Intronic
1199915944 X:152341048-152341070 CAGAGTGATAAAATGGACTTTGG - Intronic
1199965458 X:152816780-152816802 CAGAATGATACAATGGACTTTGG - Intergenic
1200171315 X:154077606-154077628 CAGAATGATACAATGGACTTTGG + Intronic
1200317614 X:155150008-155150030 CAGAATGATACAATGGACTTTGG - Intergenic
1200545960 Y:4518686-4518708 CAGAATGTAAAAGTGGACTTGGG + Intergenic
1201461383 Y:14229117-14229139 AAGAATGATAAAATGGACTTTGG - Intergenic