ID: 1194973838

View in Genome Browser
Species Human (GRCh38)
Location X:100373295-100373317
Sequence TAAAACTAGGAGAAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 620
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 562}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194973838 Original CRISPR TAAAACTAGGAGAAGGAGGC TGG (reversed) Intronic
900332066 1:2140354-2140376 TGAAAATATGAGCAGGAGGCCGG + Intronic
900510557 1:3058227-3058249 TAAAAGTGGAAGAGGGAGGCAGG - Intergenic
900716610 1:4149027-4149049 TAAAACTGGGAAAATGGGGCTGG + Intergenic
902176999 1:14657821-14657843 AAACACTAGGAGCAGGAGACAGG - Intronic
902717894 1:18285134-18285156 GAAAACAAAGAGAAGGAGGTTGG + Intronic
903021358 1:20397536-20397558 GAAGACAAGGAGAAGGGGGCTGG + Intergenic
903048893 1:20586504-20586526 TAAAACTAAGAAAAGTTGGCTGG - Intergenic
904080822 1:27871785-27871807 TAAAACAGGGAGAAGAGGGCCGG - Intergenic
904355660 1:29937445-29937467 AAGAGCTAGGAGAAGGAGACTGG + Intergenic
904715046 1:32461390-32461412 CAGCACTAGGAGAACGAGGCAGG - Intergenic
904730101 1:32583902-32583924 TAAAAATACGAAAAGGAGCCAGG - Intronic
905565916 1:38964725-38964747 TGAACCTAGGAGGTGGAGGCAGG - Intergenic
905977348 1:42186212-42186234 TAAAACAAGAGGAAGCAGGCTGG + Intronic
907074516 1:51566268-51566290 TGGAGATAGGAGAAGGAGGCTGG - Intergenic
907133475 1:52117886-52117908 TAGAACTAGGAGCCGGAGGGTGG + Intergenic
907407545 1:54262864-54262886 TGAATCTGGGAAAAGGAGGCAGG + Intronic
908391941 1:63691123-63691145 GGAGACCAGGAGAAGGAGGCAGG + Intergenic
908532822 1:65049794-65049816 CAATGCTAAGAGAAGGAGGCAGG - Intergenic
909183163 1:72450251-72450273 TATAACTAGTAGCAGCAGGCAGG - Intergenic
909323245 1:74316993-74317015 GAAAAATAAAAGAAGGAGGCTGG - Intronic
910408359 1:86914410-86914432 GTAAACTTGGAGAAGAAGGCGGG - Exonic
910591717 1:88933402-88933424 AAAAAATAGGGGAAGGAGGGAGG + Intergenic
910994644 1:93090957-93090979 TAAAACTAGGAAAAATAGGCTGG - Intronic
911211179 1:95139536-95139558 TGAACCTGGGAGACGGAGGCTGG - Intronic
912336432 1:108867009-108867031 AAATACTAGTAGAAGGAGGGAGG + Intronic
912419017 1:109530985-109531007 TATAAATAGCAGAGGGAGGCTGG - Intergenic
912468900 1:109893046-109893068 TGAAACTAGGAGAAGGTGGAGGG + Intergenic
912563936 1:110571637-110571659 TAAAACTGGGGGGAGGGGGCAGG + Intergenic
913561201 1:120022029-120022051 TAAAAATGGGAGACTGAGGCAGG + Intronic
913613671 1:120533945-120533967 TTAAAGTAGGAAAAGTAGGCAGG - Intergenic
913636926 1:120771573-120771595 TAAAAATGGGAGACTGAGGCAGG - Intergenic
914281786 1:146181439-146181461 TAAAAATGGGAGACTGAGGCAGG + Intronic
914372896 1:147045796-147045818 TCAAAGTAGGAAAAGTAGGCAGG - Intergenic
914542830 1:148632377-148632399 TAAAAATGGGAGACTGAGGCAGG + Intronic
914576596 1:148976936-148976958 TTAAAGTAGGAAAAGTAGGCAGG + Intronic
914623805 1:149438866-149438888 TAAAAATGGGAGACTGAGGCAGG - Intergenic
914730750 1:150368126-150368148 CTAAACAATGAGAAGGAGGCAGG - Intronic
914739056 1:150447965-150447987 CAAAACTGGGAGAAGGAGAAAGG - Intronic
915213912 1:154327972-154327994 AGAGACTGGGAGAAGGAGGCTGG + Intronic
915395098 1:155577382-155577404 TAAAACTTGGAGGGGGCGGCCGG - Intergenic
915507444 1:156366795-156366817 GAAAACAAGGAGGAGTAGGCTGG - Intronic
915805584 1:158845534-158845556 TAAAACTTTGAGCAGGAGGCCGG - Intronic
917792984 1:178511752-178511774 CAAAATTAGCAGAAGGAGGTGGG + Intergenic
918000950 1:180495046-180495068 TAAAACTGGGACAAGGAAGATGG + Intronic
919958254 1:202439662-202439684 TCCAACTTGGAGAAGGGGGCCGG - Intronic
919999623 1:202787589-202787611 TAAAAGTATGTGAAGTAGGCCGG + Intronic
921145079 1:212347280-212347302 GAAAACTAAGAGAAACAGGCAGG - Intronic
921705748 1:218321224-218321246 TAAAACTAGGCCAAGGAAGGTGG + Intronic
922464642 1:225838740-225838762 TAAAACTCGTAGAAAGAGCCGGG - Exonic
924458844 1:244240150-244240172 TAAAAATAAAAGAAAGAGGCTGG + Intergenic
924715541 1:246569722-246569744 CAACACTAAGAGAAAGAGGCTGG - Intronic
1063034004 10:2267371-2267393 TATAAAGAGGAGAAGGAGGAAGG + Intergenic
1063040304 10:2331349-2331371 TAAAGCGAGGAGAAGGGGGAGGG + Intergenic
1063993261 10:11590111-11590133 TAAAAGTAGGAGTGGGAGACTGG + Intronic
1064247777 10:13683017-13683039 AAAACCTAAGAGAAGGAAGCAGG + Intronic
1064505130 10:16020663-16020685 AAAACCTAGGGGAAGGAGGAGGG + Intergenic
1064607240 10:17056313-17056335 TAAAACTTCTAGAAGGAGCCGGG + Intronic
1065282072 10:24149612-24149634 TAAAAATGGGAGAAGGATGAAGG + Intronic
1065527910 10:26641122-26641144 GCAAACTAGGGGCAGGAGGCAGG - Intergenic
1065876122 10:29998933-29998955 TAAAAACGGGAGAAGGAAGCAGG + Intergenic
1065928518 10:30457968-30457990 TTAAACTAGGAGAATAATGCAGG - Intronic
1066631498 10:37463022-37463044 TAAAACAAGCAGGAGGCGGCTGG - Intergenic
1068090183 10:52424130-52424152 TAAAACTAGAAGAATTAGCCAGG - Intergenic
1069396518 10:67995178-67995200 TAAAACTACTACATGGAGGCAGG + Intronic
1069885740 10:71622496-71622518 TCAGACTAGCAGAAGGGGGCGGG + Intronic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1071703922 10:87976114-87976136 TAAATTTTGGAGAAGTAGGCAGG + Intergenic
1072295179 10:94002136-94002158 TGAATCTAAGAGAAGAAGGCAGG + Intronic
1072445743 10:95497189-95497211 GTAAACAAGGAGGAGGAGGCAGG + Intronic
1072672064 10:97437642-97437664 TCAAAAGAAGAGAAGGAGGCCGG - Intronic
1073178115 10:101568908-101568930 TCAAACAAGGGGAGGGAGGCTGG + Intergenic
1073364595 10:102928288-102928310 TAAAAATAATAGAAGGTGGCCGG + Intronic
1073489132 10:103841115-103841137 TAAAAATAGGAGTATGAGGTCGG + Intronic
1073525437 10:104177380-104177402 TAAATGTAGGAGAAGGATGGCGG + Intronic
1073818401 10:107233059-107233081 TGAAACTAGGACAAGGGGACTGG - Intergenic
1075055483 10:119215391-119215413 TAAAAGAAGCAGAGGGAGGCAGG + Intronic
1075656956 10:124168431-124168453 TAAAAATAGCAGACTGAGGCTGG - Intergenic
1076272210 10:129163499-129163521 TCTAACTAAGAGAAAGAGGCTGG - Intergenic
1076989510 11:264007-264029 TAAAACTATGAAAATTAGGCTGG + Intergenic
1077245918 11:1538156-1538178 TAAAAAGAGGAGAAGGAAGGAGG - Intergenic
1077680474 11:4235909-4235931 TAAATGTAGCTGAAGGAGGCAGG - Intergenic
1077684755 11:4281327-4281349 TAAATGTAGCCGAAGGAGGCAGG - Intergenic
1077690437 11:4336603-4336625 TAAATGTAGCCGAAGGAGGCAGG + Intergenic
1077882178 11:6359813-6359835 TAACACAAAGAGAAGGAGGCTGG + Intergenic
1077996512 11:7457074-7457096 TATAAGGAGGAGATGGAGGCAGG - Intronic
1078106761 11:8362777-8362799 GAAAAAAAGGAGAAGGAAGCTGG - Intergenic
1078241437 11:9534303-9534325 TAAAAGTGGGAAAAGCAGGCTGG - Intergenic
1078785826 11:14491372-14491394 TAGAACTGGGAGAAGGAGCCGGG + Intronic
1079939420 11:26659615-26659637 TAAGCCCAGGAGATGGAGGCTGG + Intronic
1080466071 11:32498574-32498596 TAAAAATAGAAAAAGGAGCCTGG - Intergenic
1080859694 11:36142589-36142611 TAAGACTAAGTGCAGGAGGCGGG - Intronic
1082720203 11:56665013-56665035 AAAAACATGGAGAATGAGGCTGG + Intergenic
1083103053 11:60330119-60330141 AAAAAGTGGGTGAAGGAGGCCGG - Intergenic
1084505178 11:69562197-69562219 TAAAACTTGGAGGGGAAGGCAGG - Intergenic
1085608324 11:77923017-77923039 TACAACTATGAGAAGAAAGCCGG + Intronic
1087018460 11:93578037-93578059 AAAAGGTTGGAGAAGGAGGCAGG + Intergenic
1087355388 11:97086946-97086968 AAAAACTAAGAGAAAGAGGAAGG - Intergenic
1087760945 11:102103921-102103943 TACAACTAGAAGCAGGATGCCGG + Intergenic
1088079125 11:105888580-105888602 TAAAAATAGAAAAAGGAGGCCGG - Intronic
1088330918 11:108650541-108650563 AAAAAAAAGGAGCAGGAGGCAGG + Intergenic
1088646760 11:111923785-111923807 AAAAACAAGGACAAGGAAGCAGG + Intronic
1089026705 11:115278401-115278423 TATAACTAGGATAAGGAGCAGGG + Intronic
1089427158 11:118387802-118387824 TAAACCTAGGAGGAGGAAGGTGG + Intronic
1089575640 11:119440910-119440932 AAAAAACAGAAGAAGGAGGCCGG - Intergenic
1089891030 11:121880915-121880937 TACATCTTGGAGAAGTAGGCAGG + Intergenic
1089954381 11:122556566-122556588 TAAAACTAGTAGAAGATGGCCGG + Intergenic
1090212034 11:124927727-124927749 TAAAAGTAGAAGAAACAGGCCGG + Intronic
1090720906 11:129472357-129472379 AAAAAGTGGGTGAAGGAGGCTGG + Intergenic
1091265061 11:134264046-134264068 TAAAATTAGGAAAAGTAGGCTGG + Intronic
1091528455 12:1330419-1330441 AAAAACTGGGAGAAGGAGTGAGG - Intronic
1091637927 12:2212015-2212037 TAAAGGTAGCAGAAAGAGGCCGG - Intronic
1091733522 12:2899595-2899617 TAAAACTTGGAGGCGGGGGCCGG + Intronic
1092001567 12:5036911-5036933 AAAAGCTAGAAGAGGGAGGCTGG + Intergenic
1092017991 12:5175466-5175488 TGCAGCTAGGATAAGGAGGCAGG - Intergenic
1092072881 12:5647468-5647490 AAAAACTTGGAGAAGGAATCAGG - Intronic
1092166370 12:6345013-6345035 TAAAAATAGGACATTGAGGCCGG - Intergenic
1093520598 12:20045903-20045925 TAAAAGTAGATGAATGAGGCCGG + Intergenic
1095388650 12:41679045-41679067 TAAAACCAGGAGGAACAGGCTGG + Intergenic
1096252917 12:50044796-50044818 TAGAGGTAGGAGATGGAGGCCGG - Intergenic
1096296097 12:50385443-50385465 TAAAACTACTAGAAGGAAACAGG + Intronic
1096809071 12:54158300-54158322 TACCACCAGGAGAAGGGGGCTGG + Intergenic
1098289528 12:68944693-68944715 AAAAACAAGGTGAAGGAGCCAGG - Intronic
1098426807 12:70373341-70373363 TAAAAGTAGAAGACAGAGGCAGG + Intronic
1098622175 12:72614984-72615006 TATAAATTGGAGAAGGAGGAGGG + Intronic
1099452265 12:82821791-82821813 TAAACCTGGGAGACGGAGGTTGG + Intronic
1099458232 12:82891100-82891122 TACTACTAGGAGTAGGAGTCAGG - Intronic
1100186972 12:92149123-92149145 AAAAACTGGTAGATGGAGGCAGG + Intergenic
1101374431 12:104158553-104158575 TAAAAGTTGAAGAAGAAGGCTGG - Intergenic
1101467849 12:104966249-104966271 TAAAAGTGGAAGAGGGAGGCAGG - Intergenic
1101852709 12:108417063-108417085 CAAAAGCAGGAGCAGGAGGCAGG + Intergenic
1102095509 12:110237433-110237455 TAAAAGTAGGCGAAGGAGGCTGG - Intergenic
1102516399 12:113449770-113449792 CAAGACTAGCAGCAGGAGGCTGG - Intergenic
1103159856 12:118720075-118720097 TAAAAGTAGGAGCAAGAGGGAGG - Intergenic
1103337801 12:120202894-120202916 TAAAACTGTCAGAAGTAGGCCGG + Intergenic
1103662613 12:122533396-122533418 TAAAAAGATAAGAAGGAGGCTGG + Intronic
1103825093 12:123731674-123731696 TAGAACCAGGAAAAAGAGGCTGG - Intronic
1104062198 12:125277978-125278000 CACAACTGGGAGAAGCAGGCTGG - Intronic
1104345907 12:127998197-127998219 TAAAAATAATGGAAGGAGGCCGG + Intergenic
1104449169 12:128855102-128855124 CAAAACTAGGAGGCTGAGGCAGG + Intronic
1104891619 12:132142947-132142969 AAAAGCTAGGGGAGGGAGGCTGG + Intronic
1105814640 13:24023645-24023667 TAAAAGTGGAAGAGGGAGGCTGG + Intronic
1106440944 13:29769526-29769548 TAAAATTAGGAGATGGGGGTTGG + Intronic
1107336321 13:39359622-39359644 GAATACAAGGAGAAGGAGGTAGG + Intronic
1109415179 13:62029646-62029668 TGCAATTAGGAGAAGGAAGCAGG + Intergenic
1110031819 13:70625045-70625067 TAAAAATACGAAAATGAGGCGGG - Intergenic
1110073731 13:71212040-71212062 AGAAATTAGGAGGAGGAGGCAGG - Intergenic
1110554463 13:76842970-76842992 TTAAAATGGTAGAAGGAGGCTGG + Intergenic
1110559348 13:76893837-76893859 TAAAACCAGGAGAAGGATACAGG - Intergenic
1110855458 13:80292685-80292707 TGAAACTATCAGAAGGCGGCCGG + Intergenic
1111739730 13:92188929-92188951 TAAAACTTGGAGAGACAGGCAGG + Intronic
1112230078 13:97580968-97580990 CAAAACTAGGATAATGAGGCCGG - Intergenic
1112315088 13:98353672-98353694 TAAAACTACAAAAAGCAGGCCGG - Intronic
1113659563 13:112096304-112096326 TACAATTAGGAAAAGGAGACAGG + Intergenic
1113841467 13:113363914-113363936 CAAAACCGAGAGAAGGAGGCCGG + Intronic
1114119784 14:19658522-19658544 TAAAATTAGTAGAATGAGACAGG - Intergenic
1114492950 14:23114560-23114582 AAAAATTTTGAGAAGGAGGCAGG - Intergenic
1114958910 14:27858193-27858215 GCAAACTAGGTGAAGGAGGAAGG - Intergenic
1115491224 14:33960199-33960221 TAAAAATACTAGAATGAGGCCGG + Intronic
1116069718 14:40028099-40028121 TATAGCTAGGAGTAGGAGGATGG - Intergenic
1116352892 14:43888111-43888133 TACAACTATGAGAAGGGAGCTGG - Intergenic
1116388102 14:44357638-44357660 GAAAAATAAGAGAAGAAGGCAGG + Intergenic
1116627145 14:47279977-47279999 AAAAACTAGGAGGCTGAGGCAGG - Intronic
1117330689 14:54708981-54709003 TAAAAATAGGTGATAGAGGCCGG + Intronic
1117415062 14:55487192-55487214 TAAAATTAGGAAAAATAGGCTGG - Intergenic
1117543230 14:56769169-56769191 TTAAAATAGGGGAAGTAGGCCGG + Intergenic
1117846995 14:59921604-59921626 ATACATTAGGAGAAGGAGGCTGG + Intronic
1119213136 14:72847804-72847826 TAAAGAAAGGAGAATGAGGCTGG - Intronic
1119260679 14:73236518-73236540 TAAAAAAAGAAGAAGAAGGCTGG + Intergenic
1119392207 14:74298565-74298587 TAATATTTGGTGAAGGAGGCTGG - Intronic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119558828 14:75573810-75573832 TTAAACAAGGAGAATGGGGCCGG - Intergenic
1120393423 14:83937553-83937575 AAGAACTCGGAGAAGGAGGATGG - Intergenic
1120445073 14:84585269-84585291 GAAAACTACTAGAAGGAGGAGGG + Intergenic
1120917659 14:89723795-89723817 TAAACCTGGGAGGGGGAGGCAGG + Intergenic
1121247541 14:92473055-92473077 AAAAACTAGAAACAGGAGGCAGG - Intronic
1121400809 14:93675308-93675330 TGAACCTAGGAGACGGAGGAAGG + Intronic
1122378884 14:101287451-101287473 TAAATGTAAAAGAAGGAGGCAGG + Intergenic
1124044608 15:26137446-26137468 GAAAAGGAGGAGAGGGAGGCAGG - Intergenic
1125241031 15:37575969-37575991 TAAAAATAGAAGGAGGAGGCCGG - Intergenic
1125385794 15:39135155-39135177 TAAAACTGAGTGAAGGAGTCAGG + Intergenic
1125446273 15:39760840-39760862 TAAGATTAGGAGAAGCAGGGGGG + Intronic
1125729771 15:41886588-41886610 TAAAACAAGAGGAAGAAGGCAGG - Intronic
1125874259 15:43130266-43130288 TAAAACTAGGAGAGAGAAGCTGG - Intronic
1125923161 15:43538806-43538828 AAAAGCTGGGAGCAGGAGGCCGG - Intronic
1126810610 15:52399407-52399429 TAATCCTAGGAGACTGAGGCAGG - Intronic
1127149770 15:56061243-56061265 TAAAAAAAGGAAAAGAAGGCTGG + Intergenic
1127660858 15:61098631-61098653 TAAGAATAGGAGTAGCAGGCTGG - Intronic
1127952412 15:63822198-63822220 ATAAACAAGGAGAGGGAGGCAGG + Intronic
1128127680 15:65204937-65204959 TAAACCCAGGAGGCGGAGGCTGG + Intronic
1128270782 15:66307600-66307622 TAAGACTGGGAGTAGGAGCCTGG - Intronic
1128661731 15:69506245-69506267 TAAAACTTGGAGACCCAGGCAGG + Intergenic
1128828525 15:70744377-70744399 TAAATCTAGCAGAAGGAAGGAGG + Intronic
1128880109 15:71235110-71235132 TTAAGCTAGGAGAGGGAGGAGGG - Intronic
1129445844 15:75617302-75617324 TAAAGAGAGGAGAATGAGGCAGG - Intronic
1129999843 15:80036864-80036886 TAAATAGGGGAGAAGGAGGCAGG - Intergenic
1131179997 15:90233306-90233328 TAAAGTTGGGAGAAGGAGCCGGG + Intronic
1131420505 15:92300950-92300972 TAAAATTAGGAGAAGGAAAAAGG + Intergenic
1131497884 15:92930676-92930698 TAATCCTAGGAGACCGAGGCTGG - Intronic
1131852113 15:96554582-96554604 AAAGAGTAGGAGAAGGAGGGAGG - Intergenic
1133530793 16:6653230-6653252 TAAACCAAGGAGAAGGGGGTGGG - Intronic
1133876671 16:9741151-9741173 TATCACTATGAGAAGAAGGCTGG + Intergenic
1134049946 16:11130526-11130548 TAAAACTCTGAGTAGGAGGAGGG - Intronic
1134146713 16:11770857-11770879 TAAAATTCTGAGAAGGAGGGTGG + Exonic
1134795476 16:17031633-17031655 GAAAACTAGCAGGAAGAGGCAGG - Intergenic
1134871353 16:17654897-17654919 TAAAAATAGAAAAATGAGGCGGG + Intergenic
1135122813 16:19781101-19781123 TAAATCCAGGAGAGGGAGACTGG + Intronic
1135476189 16:22777785-22777807 TAAAAATAGGAGATATAGGCTGG + Intergenic
1135912492 16:26574094-26574116 TGTAAGTAGGAGAGGGAGGCAGG + Intergenic
1136561515 16:31042001-31042023 TAAAACTAGGTGTCGGGGGCCGG - Intronic
1136778665 16:32884485-32884507 CAAAGTTAGGAGAAGGATGCTGG - Intergenic
1136891955 16:33977029-33977051 CAAAGTTAGGAGAAGGATGCTGG + Intergenic
1136997750 16:35202398-35202420 TGAGACTGGGAGAAGCAGGCAGG + Intergenic
1137376367 16:47955461-47955483 TAAAACAAGGAGAAGGAAATTGG - Intergenic
1137413927 16:48254620-48254642 TAAAATTCAGAGATGGAGGCCGG - Intronic
1137515198 16:49137411-49137433 CACAACTAGGCAAAGGAGGCAGG + Intergenic
1137630749 16:49942382-49942404 TAAAAATGGGCAAAGGAGGCTGG + Intergenic
1139142396 16:64282586-64282608 TAAAACTGGCAGAAGGAGAGGGG + Intergenic
1139718713 16:68835613-68835635 CAAAACGTGGAGAAAGAGGCCGG + Intergenic
1140787765 16:78360287-78360309 TAGAAGTTGGAGAAGTAGGCTGG + Intronic
1140936986 16:79681244-79681266 TGAACCTGGGAGATGGAGGCTGG + Intergenic
1142048442 16:87941552-87941574 TAAAAATAGAAGAATGAGCCGGG + Intergenic
1203081081 16_KI270728v1_random:1146579-1146601 CAAAGTTAGGAGAAGGATGCTGG - Intergenic
1143194405 17:5064546-5064568 TAAAATTTGGAGGAGGAGGCTGG - Intergenic
1143905805 17:10208174-10208196 TAAAAAGGGGGGAAGGAGGCTGG + Intergenic
1144496252 17:15747478-15747500 TAAAGATAGGTGGAGGAGGCTGG + Intronic
1145020927 17:19430092-19430114 CAAAACAAGGAGAAGCAGGGAGG + Intergenic
1146073408 17:29705071-29705093 AACAACTGGGAGAATGAGGCTGG - Intronic
1146491949 17:33289815-33289837 TAAAACTTGGAGCAGGAGCGAGG + Intronic
1146616724 17:34362550-34362572 AAAAACTAGGAGGAAGAAGCTGG - Intronic
1146725275 17:35150993-35151015 TAAACCCAGGAGAAAGAGGTTGG - Intronic
1146736388 17:35242556-35242578 AATTACTAGGAGAAGGAGGGAGG + Intergenic
1147115550 17:38296803-38296825 TTAAAAAAGGAAAAGGAGGCCGG - Intergenic
1147801154 17:43089329-43089351 AAAAATTAGGAGAAAGAGCCTGG + Intronic
1148083356 17:44979629-44979651 TAAAACTAGGAGCAGAACTCAGG + Intergenic
1148414128 17:47492817-47492839 TTAAAAAAGGAAAAGGAGGCCGG + Intergenic
1148513175 17:48190687-48190709 TAAAAGTCTGAGAAAGAGGCTGG + Intronic
1148519410 17:48256547-48256569 GAAAACTAGGACTAGGATGCTGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149422151 17:56521455-56521477 TGAAACCAGGAGAAGGGGGTGGG + Intergenic
1149444527 17:56703471-56703493 AAATGATAGGAGAAGGAGGCCGG - Intergenic
1149684657 17:58528426-58528448 TAGAACCAGCAGATGGAGGCTGG + Intronic
1150127024 17:62643536-62643558 TAAAACTATGAGAAAAACGCAGG + Intronic
1150895577 17:69206806-69206828 TAAAACTACTAGAAGGAAACGGG + Intronic
1151329054 17:73396171-73396193 TCAAACAAGAAGGAGGAGGCTGG - Intronic
1151557475 17:74853968-74853990 AAAAGCCTGGAGAAGGAGGCGGG - Intronic
1151850158 17:76685224-76685246 TAAACCTAGGGAAAGGGGGCCGG - Intronic
1152834129 17:82518839-82518861 TAAACCTGGGAGGCGGAGGCAGG - Intergenic
1153270771 18:3318987-3319009 TAAAACAAAGAGGAGGGGGCCGG - Intergenic
1153331696 18:3880644-3880666 GAAAACTAGAAAAAGGAGGCCGG + Intronic
1153377965 18:4402482-4402504 GAAAACTATGGGAAGCAGGCCGG + Intronic
1155161395 18:23198612-23198634 TAAAAGCGGAAGAAGGAGGCAGG + Intronic
1156537846 18:37880913-37880935 TAAAGGTAGGAGGAGCAGGCCGG - Intergenic
1157079359 18:44506082-44506104 TCATACTAGGAGAAGGAATCAGG + Intergenic
1158134995 18:54198335-54198357 TAAAAGCAGGAGAAGGAGCTTGG - Intronic
1158217774 18:55117724-55117746 AAAAAGTAGAAGAAGGAGGAGGG + Intergenic
1158434434 18:57425928-57425950 TAAAACTTTTTGAAGGAGGCTGG + Intergenic
1158561085 18:58514289-58514311 AAAAACTGGGAGAAGGAAGAAGG - Intronic
1159072350 18:63640118-63640140 TAAAAGTAGGAAGAGGAGGGAGG - Intronic
1159266290 18:66084078-66084100 TAAAACTAGGAGGAGTCAGCTGG - Intergenic
1159782049 18:72671247-72671269 TCAAACTAGGAGAAGAATTCTGG - Intergenic
1160098903 18:75902378-75902400 TGAAACTAGGACAAACAGGCTGG + Intergenic
1160794818 19:940447-940469 TGGAGCTGGGAGAAGGAGGCTGG + Intronic
1161232693 19:3182663-3182685 TAAAAATAGGAAAATGAGCCAGG - Intergenic
1161806032 19:6443522-6443544 TATAAAGGGGAGAAGGAGGCCGG - Intronic
1162207021 19:9063807-9063829 TAAAAATAGAGAAAGGAGGCTGG - Intergenic
1162826082 19:13253097-13253119 TAGAACTAGGGGAAAGAAGCAGG + Exonic
1163160069 19:15458908-15458930 TAAAACAAGGCCAGGGAGGCTGG - Intronic
1163462828 19:17448885-17448907 TAAAACAAGAAAAAGGAGGCCGG + Intronic
1163878685 19:19898803-19898825 TGACGCTAGGAGATGGAGGCTGG - Intergenic
1164114151 19:22200843-22200865 AAAAAATAGAAGAAGCAGGCTGG - Intergenic
1164515558 19:28932459-28932481 TAGAACCAGGAGATGGAGGGGGG - Intergenic
1165136186 19:33671009-33671031 GATGACTGGGAGAAGGAGGCTGG - Intronic
1165273102 19:34727055-34727077 TAACAATAGGAGGAGGAGGAGGG - Intergenic
1165705699 19:37974842-37974864 TAAAACTAGGATAAGGGAGAAGG - Intronic
1166093525 19:40525528-40525550 CAAAACGAGGAGGAGGAGCCCGG + Intronic
1166279116 19:41778765-41778787 TAAAACAAGGACAAAGCGGCCGG - Intergenic
1166410222 19:42551727-42551749 TATAAGTAAGAGAGGGAGGCAGG + Intronic
1167086362 19:47312380-47312402 AAAGATAAGGAGAAGGAGGCTGG - Intronic
1167457460 19:49604726-49604748 TAAAACTTGGAGATGGATGGTGG - Intronic
1168135798 19:54350506-54350528 TCCAAATAGGAGAAGGAGGAGGG + Intergenic
924971339 2:130352-130374 GAAAATCAGGAGAAGTAGGCAGG + Intergenic
925516414 2:4688489-4688511 TAAGACTATGGGAAGGAGGAAGG + Intergenic
925517134 2:4695409-4695431 CAAAAGTGGGAGAAGGGGGCAGG + Intergenic
925666319 2:6260302-6260324 TATAACTTGGAGACAGAGGCGGG - Intergenic
926082011 2:9994936-9994958 AAAAACCAGGGGAAGGAGGCTGG - Intronic
926550791 2:14298712-14298734 CCAAACTAGGAGCAGGAGGCAGG - Intergenic
927041305 2:19233097-19233119 TAAAAATAGGAACAGGAGGTCGG - Intergenic
927127995 2:20030915-20030937 TAAAAGTGGGCAAAGGAGGCTGG + Intergenic
927415282 2:22872882-22872904 GATAAGTAGGAGAAGGATGCTGG - Intergenic
927951826 2:27175611-27175633 TAGAACGGGGAGAAGGAGCCAGG - Intergenic
928183554 2:29088795-29088817 TAAAACTAGTAGAAGGAAATAGG - Intergenic
928234198 2:29525708-29525730 TGAACCCAGGAGACGGAGGCTGG + Intronic
928660882 2:33500638-33500660 TAAAAAAATGAGAAGGAGGTGGG + Intronic
929113913 2:38428485-38428507 AAAAAATAGAAGAAGGAGGGTGG - Intergenic
929672567 2:43888847-43888869 TAAAGCTAGCAGCAGGAGGTAGG + Intronic
930208183 2:48609138-48609160 TAAGACAAAAAGAAGGAGGCAGG - Intronic
930357910 2:50345182-50345204 GAGAACTAGGAGAAGGAGAAAGG + Intronic
931837588 2:66115062-66115084 AGAAACAAGGAGAAGGAGGTTGG + Intergenic
932252121 2:70253531-70253553 TTAAACTTGGAGAAAGAGGCTGG - Intergenic
932917998 2:75877812-75877834 TAAAATTAGGAGAAGGAAAAAGG + Intergenic
934478434 2:94610301-94610323 GCAAACTAGGTGAAGGAGGAAGG + Intergenic
934760398 2:96852526-96852548 AAAAACCTGGAGAAGGGGGCAGG + Intronic
935406012 2:102709383-102709405 CAATACTAGGAGGAGGAGGCAGG + Exonic
935443514 2:103131657-103131679 TGAACCTAGGAGGTGGAGGCTGG + Intergenic
935868030 2:107413010-107413032 CAATACTAGGAGAAAGAGACGGG + Intergenic
936121630 2:109751153-109751175 TAAAACTAGGACTAGGATCCAGG + Intergenic
936223067 2:110620321-110620343 TAAAACTAGGACTAGGATCCAGG - Intergenic
936608370 2:113979194-113979216 TTCAACTAGGAGGAGGAGGTTGG + Intergenic
936800795 2:116262485-116262507 TCAAACATGAAGAAGGAGGCAGG + Intergenic
937002453 2:118479875-118479897 AAAAACTTTGAGAAGTAGGCAGG - Intergenic
938421100 2:131147500-131147522 TAAAACTTGGAGAAGCTGGCTGG + Exonic
938785666 2:134626399-134626421 TAAAAGCTGGAAAAGGAGGCTGG - Intronic
939354087 2:141078395-141078417 ATTAGCTAGGAGAAGGAGGCAGG - Intronic
940182136 2:150946430-150946452 TAAAAATAAGAAAAGGAGTCTGG - Intergenic
940226179 2:151403404-151403426 TAAACCCAGGAGATGGAGGTTGG - Intergenic
940253720 2:151707508-151707530 TACAAGTAGGAGGAGGAGGATGG + Intronic
940589108 2:155697783-155697805 TAAAACTGGGTGATGGAGGCAGG - Intergenic
941021920 2:160416546-160416568 AAAGTCTAGGGGAAGGAGGCAGG + Intronic
941671609 2:168299723-168299745 TAAAAATGGGAGAGAGAGGCTGG - Intergenic
941732425 2:168933345-168933367 TAAGACAAGTAGAAGGAGACAGG - Intronic
942419011 2:175788330-175788352 TAAAAATAAGAGAATGAAGCTGG + Intergenic
942426482 2:175865841-175865863 TATAAGTGAGAGAAGGAGGCAGG + Intergenic
942863611 2:180645950-180645972 TAAAAATAAAAGAAGGATGCTGG - Intergenic
943190160 2:184665910-184665932 TAAATGTGGAAGAAGGAGGCAGG - Intronic
943577136 2:189643072-189643094 AAAAAAAAGGAGAAGGAGGGAGG - Intergenic
943692985 2:190888037-190888059 TAAAAGTAACAAAAGGAGGCAGG - Intronic
943792246 2:191946475-191946497 TAAAAATAGGACAAGGTGACTGG - Intergenic
944644980 2:201770675-201770697 TAAAAGTGGAAGAGGGAGGCAGG + Intronic
945155438 2:206832850-206832872 TAAATGAAGGAGAAGGAGGAAGG - Intergenic
946269473 2:218578654-218578676 TAAAAGAAGGAGCGGGAGGCGGG - Intronic
946410907 2:219514773-219514795 AAACCCAAGGAGAAGGAGGCAGG + Exonic
946656667 2:221955920-221955942 TAAAAATATGAAAATGAGGCCGG + Intergenic
947053141 2:226069836-226069858 TAAAAATAGGAGAAGTAAGTGGG + Intergenic
948635382 2:239331275-239331297 AAAAGCCACGAGAAGGAGGCAGG + Intronic
1168731132 20:82021-82043 TAAAAGAAGGAGAAATAGGCTGG + Intergenic
1168888592 20:1278358-1278380 TAAAGCTAGAAGGAGGAGGATGG - Intronic
1169158108 20:3351402-3351424 TGAACCTAGGAGGTGGAGGCTGG + Intronic
1170080932 20:12474490-12474512 TAAAGCTAGGAGCAGTAGGTGGG - Intergenic
1170155347 20:13264128-13264150 TGAAACTGGGGGAAGGAGGAGGG + Intronic
1170248332 20:14249416-14249438 AAAACCAAGGAGAAGGTGGCAGG + Intronic
1170510173 20:17068270-17068292 TAAAATATGGAGGAGGAGGCAGG + Intergenic
1170787143 20:19477363-19477385 CAAATCCAGGAGAAAGAGGCAGG + Intronic
1171071750 20:22075922-22075944 TAAAACTTGTAGAAGGAAACAGG - Intergenic
1171339920 20:24419817-24419839 CAGACCTAGTAGAAGGAGGCAGG + Intergenic
1172181332 20:33005498-33005520 TAAAAATGGAAGAGGGAGGCAGG + Intergenic
1172183400 20:33017013-33017035 TAAGACAGAGAGAAGGAGGCTGG - Intronic
1172304850 20:33873485-33873507 TAAAAATAGGAGCAAGAGCCTGG - Intergenic
1172334885 20:34107027-34107049 AAAAATTAGCAGAAGGTGGCGGG + Intronic
1172569864 20:35961582-35961604 AAAAAGCAGGAGAGGGAGGCAGG - Intronic
1172679284 20:36699822-36699844 TAAAAGTAGATGAGGGAGGCCGG + Intronic
1172682932 20:36730856-36730878 TAAAACTGGGAGGAGGAGGTTGG + Intronic
1173134812 20:40430128-40430150 TAAAACAAGAGGAAAGAGGCCGG + Intergenic
1173676827 20:44843359-44843381 TAAAAGTGGAAGAGGGAGGCAGG - Intergenic
1173961730 20:47078253-47078275 GAACACTAGGAAAAAGAGGCAGG - Intronic
1175354930 20:58357315-58357337 TAAAACATTAAGAAGGAGGCAGG - Intronic
1175577749 20:60075283-60075305 TAAAAATTGGAGATGGAGGCTGG + Intergenic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1175902031 20:62363735-62363757 TCATCCTAGGAGGAGGAGGCAGG + Intronic
1176721412 21:10396801-10396823 AAAAAAAAGGAGAAGAAGGCTGG + Intergenic
1177379646 21:20322880-20322902 TAAAACTAGTAGAAGAAAACAGG - Intergenic
1177661927 21:24095842-24095864 TAGGTCTAGAAGAAGGAGGCTGG - Intergenic
1178766105 21:35452343-35452365 TAAAAGTGGAAGAGGGAGGCAGG - Intronic
1179189651 21:39112823-39112845 GAAAAGGAGGAGAAGGAGGATGG + Intergenic
1179200844 21:39219127-39219149 AAAAATAAGGAGAAGCAGGCAGG + Intronic
1180462961 22:15583563-15583585 TAAAATTAGTAGAATGAGACAGG + Intergenic
1181829488 22:25548353-25548375 TAAAAGAGGGAGAAGGAGGGAGG + Intergenic
1182771559 22:32800634-32800656 TAAAACCAGGAGAACGATCCAGG - Intronic
1183033558 22:35123519-35123541 TAAAAGGTGGAGAAGGCGGCAGG - Intergenic
1183881477 22:40835065-40835087 AAAAATTAGGAGAAGGCGGGGGG - Intronic
951037937 3:17954090-17954112 TAAAAATGGGAGACTGAGGCAGG - Intronic
952921892 3:38291082-38291104 TAAAATTAGGAGAAGGAAAAAGG - Intronic
953380875 3:42472072-42472094 TAAAAATAGCATAAGCAGGCCGG - Intergenic
954702368 3:52456828-52456850 GGAAACTAGGTGCAGGAGGCGGG + Intronic
955065715 3:55532210-55532232 TAAAGCTGGGACAAGGATGCAGG - Intronic
955197555 3:56819339-56819361 TAAAACATGGAGAAGGATGAGGG - Intronic
955239878 3:57169012-57169034 TAAAAAGAGGAGATGGAGACTGG - Intronic
955250303 3:57275152-57275174 CAAAACTATTAAAAGGAGGCTGG + Intronic
955498022 3:59556512-59556534 TAAAAATAGGAGAGGGAGGAGGG + Intergenic
956457130 3:69433416-69433438 TAAAAACAGGACAAGGAGGGAGG + Intronic
956498780 3:69859081-69859103 TAAAACTAGGATACGAAGGGTGG + Intronic
957158237 3:76573886-76573908 TTAAACTAGGCCAAGGAGGATGG - Intronic
957885005 3:86275488-86275510 AAGAACTAAGAAAAGGAGGCAGG - Intergenic
958664465 3:97117422-97117444 TAAAACTACTAGAAGGAAACGGG - Intronic
959034658 3:101346940-101346962 TAAAAAAAGGAGGAGGAGGGAGG + Intronic
959240585 3:103787303-103787325 TAAAACTAGGAGAAAGTAGCAGG - Intergenic
959708268 3:109359288-109359310 CAACACTGGGAGAATGAGGCAGG - Intergenic
960275844 3:115728315-115728337 TAAATCAAGGAGAAGAAGGCAGG - Intergenic
960479794 3:118173716-118173738 TAAAACTAATAGAAGAAAGCTGG - Intergenic
961228049 3:125271815-125271837 TAAAAGAACCAGAAGGAGGCAGG - Intronic
961233961 3:125347677-125347699 TAAAATTAGGAGGCTGAGGCAGG - Intronic
961266518 3:125647506-125647528 GAAAACAAGGAGCACGAGGCTGG + Intergenic
961764040 3:129194332-129194354 TAAAAATACAAGAAGTAGGCCGG + Intergenic
961781381 3:129322663-129322685 TAAAAGTAACAGAATGAGGCCGG + Intergenic
961846188 3:129765865-129765887 TAAAACTGGGAAGAGGAGGGTGG + Intronic
961860458 3:129913080-129913102 TAAAACTAGGAAAAGCAGAGAGG - Intergenic
962005796 3:131348417-131348439 AAGAACTATGAGAAGGAGCCTGG + Intronic
963629565 3:147716174-147716196 TAGTACTAAGAGAAGGAGCCTGG + Intergenic
964711322 3:159674661-159674683 TAAAAGTAGGATAAGAAGGGAGG + Intronic
964878403 3:161395789-161395811 GAAAACAAGGAGAAGGAGCCAGG + Intergenic
965076004 3:163977303-163977325 TAAAAGAAGGAGAAGGGGGCTGG - Intergenic
965396699 3:168167889-168167911 TAAACCTATGAAAAGGTGGCTGG + Intergenic
966026214 3:175286288-175286310 AAAAAGGAGGAGGAGGAGGCTGG + Intronic
966694242 3:182773273-182773295 TAAAACTACTAGAAGAAGACAGG - Intergenic
967315628 3:188149877-188149899 GAAAACTACTAGAAGGAGGGTGG + Intergenic
968455421 4:696037-696059 TAAGACTGTGAGATGGAGGCTGG + Intergenic
969645292 4:8424979-8425001 TAAAATTAGGAGAAGGAAAAAGG + Intronic
970127904 4:12834908-12834930 GAAAATTATGAGAAGGAGGCCGG - Intergenic
970634864 4:17997732-17997754 AAAAACTGGGAGAAAGAGGATGG + Intronic
970648645 4:18152739-18152761 TAAACTCAGGAGAATGAGGCAGG + Intergenic
971151371 4:24035459-24035481 TGAACCTGGGAGAAGGAGGTTGG + Intergenic
972090763 4:35279664-35279686 TAAAACTGGTGGAAGGGGGCTGG - Intergenic
972549073 4:40110832-40110854 TAAAAATGGGCAAAGGAGGCTGG - Intronic
973842450 4:54875979-54876001 TAAAACTAGGGGAAACTGGCTGG + Intergenic
974220464 4:58962700-58962722 CAAAACTAGGGCAAGGAGGAGGG - Intergenic
974258820 4:59498051-59498073 TAAAAATGTGAGAAGGAGGCCGG + Intergenic
974860947 4:67520713-67520735 TAAAACTAGGAAAGAGGGGCTGG + Intronic
975211362 4:71703895-71703917 TAAAAGTGGAAGAAGGAAGCAGG - Intergenic
977997949 4:103517557-103517579 TAAAAATATTAGAAAGAGGCTGG - Intergenic
978708400 4:111746074-111746096 TAAAAATAGAAGAAAGAGGAAGG - Intergenic
978808828 4:112828855-112828877 TAAAAATGGGCAAAGGAGGCTGG + Intronic
978885765 4:113764225-113764247 TGAACCTGGGAGAAGGAGGGAGG + Intergenic
979833458 4:125330352-125330374 TAGAAATTGGTGAAGGAGGCTGG - Intronic
980578048 4:134711201-134711223 AAGAACTAGGAAAAGAAGGCAGG + Intergenic
982016258 4:151156703-151156725 TAAAACTACTAGAAGAAAGCAGG + Intronic
982635675 4:157893971-157893993 TCTAACAAGGAGGAGGAGGCAGG + Intergenic
984480065 4:180288937-180288959 TAAAACCAGAAGAAGGAAACAGG - Intergenic
984509564 4:180662111-180662133 TAAAATGAGGACAGGGAGGCAGG - Intergenic
984543452 4:181070133-181070155 TAAAACGTGGAGAAGGATGATGG + Intergenic
984578460 4:181479389-181479411 GAAAACTAGGAGAAGGATTTTGG + Intergenic
985182220 4:187277417-187277439 TAATATGAGGAGAAGGAGGCTGG - Intergenic
985198774 4:187462313-187462335 TAAAATTTGGAGAAGCAGCCAGG + Intergenic
985248740 4:188002014-188002036 TAAAACTAGAAAAAGTAGCCAGG + Intronic
985299396 4:188471974-188471996 TAAAAGTAGTATAAGGGGGCTGG - Intergenic
985675364 5:1228660-1228682 TAAAACTAGGAGCTGCAGCCTGG + Intronic
986004772 5:3658445-3658467 AAAAACAAAGAGAAGGGGGCTGG - Intergenic
986890965 5:12304971-12304993 TGAAACTAAGAGAAGAAAGCAGG + Intergenic
987047919 5:14124828-14124850 AAAAAAATGGAGAAGGAGGCCGG + Intergenic
988820063 5:34874369-34874391 TCAAATTAGGAGCAGAAGGCAGG + Intronic
988995036 5:36706514-36706536 TAAAAGTGGAAGAAGGAGGCAGG + Intergenic
989077978 5:37585284-37585306 TAAAAAATGGACAAGGAGGCTGG - Intronic
989753715 5:44925622-44925644 TAAGAAGATGAGAAGGAGGCCGG - Intergenic
990472173 5:56125835-56125857 TAAAATTATGATAAGTAGGCTGG + Intronic
992199326 5:74368328-74368350 GAAAAGGAGGAGGAGGAGGCAGG + Intergenic
992501298 5:77346800-77346822 TAAAACAAGAGGAAGGAGGAAGG + Intronic
992691896 5:79248602-79248624 TATAATTATAAGAAGGAGGCCGG - Intronic
992829994 5:80584785-80584807 AGAGACTTGGAGAAGGAGGCAGG - Intergenic
993036189 5:82760436-82760458 TAATGATAGGAGCAGGAGGCAGG + Intergenic
993288572 5:86035102-86035124 TAAAACTAGTAGAAGAAAACAGG + Intergenic
995640491 5:114251216-114251238 TAACAATGGGAGAAGCAGGCTGG - Intergenic
996112236 5:119579616-119579638 TAAAACTAGGAAGAGGTGGGTGG - Intronic
996270660 5:121600949-121600971 TAAAACTAGTAGAAGAAAACAGG - Intergenic
996587580 5:125107739-125107761 TAGAAGGAGGAGAAGGAGGAGGG - Intergenic
996992013 5:129646182-129646204 TAAAAATTGGAAAAGGAGGCCGG - Intronic
997649966 5:135509649-135509671 TAAAAGGAGGGGAAAGAGGCAGG - Intergenic
998222424 5:140296811-140296833 ACAAACTAGTAGAAGGAGGTAGG + Intronic
998880299 5:146638437-146638459 AGGAACCAGGAGAAGGAGGCAGG + Intronic
999325171 5:150639311-150639333 GAAACCCAGGGGAAGGAGGCTGG - Intronic
999848654 5:155513365-155513387 TAAAACTTGGGGAAGGAAGTAGG - Intergenic
1000909163 5:166999935-166999957 TAAAATGAGGAAAAGGAGGTGGG + Intergenic
1001274453 5:170340261-170340283 TAGAAAGAGGAGAGGGAGGCTGG - Intergenic
1002016285 5:176325757-176325779 TAAAGATAAGAGAAGAAGGCAGG - Intronic
1002125418 5:177039820-177039842 TAAAACTGGGAGAGGAGGGCAGG - Intronic
1002647140 5:180664453-180664475 TAACAATGGGAGAAGGTGGCCGG + Intergenic
1003246824 6:4388899-4388921 TAATATTAGGAGCTGGAGGCCGG - Intergenic
1003439721 6:6128335-6128357 TAATACAAAGAGAAGTAGGCTGG + Intergenic
1004387211 6:15183534-15183556 AAAAAGAAGAAGAAGGAGGCTGG - Intergenic
1005907027 6:30271153-30271175 CAAAACTTGGAGAAGAAAGCAGG + Intergenic
1005966635 6:30731186-30731208 TAAAAATAGGAGCCGGTGGCCGG + Intronic
1006555168 6:34859601-34859623 CAGAACTAGGAGAAGGAGATGGG - Intronic
1006742291 6:36317840-36317862 TAAAACCAGAAGATGGAGTCAGG + Intronic
1007359253 6:41343283-41343305 TATAGATAGGAGGAGGAGGCAGG - Intronic
1007658221 6:43465777-43465799 TAAAACTAGAATAATAAGGCTGG - Intergenic
1008042420 6:46816251-46816273 TAAAAATAGAAGAATGAGGCCGG - Intronic
1008881962 6:56389064-56389086 TAAAAATATGCAAAGGAGGCTGG + Intronic
1008908880 6:56711793-56711815 TAAAAATAGGAGGAGGTGGCCGG + Intronic
1009545115 6:65010716-65010738 TAAAATTAGGAGAAGGAAAAAGG + Intronic
1010203831 6:73306172-73306194 TATAAGTAGGAGCAGGAGGCAGG - Intronic
1010575929 6:77531132-77531154 TAAAACTAGGAGGAGTAGAAGGG + Intergenic
1010679002 6:78777242-78777264 GAAAAATAGGAAGAGGAGGCTGG - Intergenic
1011967321 6:93175082-93175104 AAAACCTAGGAGATGGAGGTGGG - Intergenic
1012596003 6:101041050-101041072 AAAAAGAAGGAGAAGAAGGCAGG - Intergenic
1012762768 6:103322784-103322806 TAAAGATTGGAGAAGGAGGAGGG - Intergenic
1012880180 6:104778053-104778075 TAAAGTTAGGAGTAAGAGGCCGG - Intronic
1013390798 6:109684576-109684598 AAAAAGTAGGCAAAGGAGGCCGG + Intronic
1013854931 6:114560868-114560890 TAATATTAGGGGAATGAGGCTGG - Intergenic
1014416505 6:121190901-121190923 TAGTACTAGGAGAAAGTGGCGGG - Intronic
1014711617 6:124812896-124812918 TAGAATTAGGAGAATGAGGAAGG - Intronic
1015885734 6:137916140-137916162 TAAAATAAATAGAAGGAGGCAGG + Intergenic
1016000473 6:139036239-139036261 TTAAAACAGAAGAAGGAGGCAGG - Intronic
1016691987 6:146948744-146948766 TATAAATAGAAGAGGGAGGCAGG - Intergenic
1017018610 6:150121675-150121697 TAAAAATAACAGAAAGAGGCTGG - Intergenic
1017331021 6:153198418-153198440 TGAACCTGGGAGACGGAGGCTGG - Intergenic
1017757920 6:157545378-157545400 AAAAAAAAGGAGGAGGAGGCCGG + Intronic
1017798434 6:157869349-157869371 AAAAACTAGGTGAAGGTGTCTGG - Intronic
1017924115 6:158896105-158896127 TAAAACTATAAAAAGGAGCCAGG - Intronic
1018448646 6:163883542-163883564 TAAAACTACTAGAAGGAAACAGG + Intergenic
1019080047 6:169424330-169424352 TCAAAGCAGGAGGAGGAGGCGGG + Intergenic
1019494974 7:1333475-1333497 TAAAAAAAGGAGAAGAAGGAGGG - Intergenic
1019853645 7:3583669-3583691 TAAAACAAGTAGTAAGAGGCAGG + Intronic
1020672217 7:11130585-11130607 GGAAACTAGGGGAAGGAGGAAGG - Intronic
1022388761 7:29925710-29925732 TAAAACTAGGAATATGAGTCTGG + Intronic
1022718238 7:32918120-32918142 TAACCCAAGGAGGAGGAGGCTGG + Intergenic
1022738249 7:33096297-33096319 TAACCCAAGGAGGAGGAGGCTGG + Intronic
1022834079 7:34097178-34097200 CAAAAAGAGGAGCAGGAGGCTGG + Intronic
1022903624 7:34834648-34834670 GAAATCTAGGAGAAGGAAGGGGG + Intronic
1023622199 7:42085346-42085368 CAAAACTAGCAGAAGCAGGTAGG + Intronic
1023874747 7:44280908-44280930 TAAAACCAGGAGAGGGATGAGGG + Intronic
1023992770 7:45139311-45139333 GAAGACTAGAAGCAGGAGGCAGG - Intergenic
1025860622 7:65323727-65323749 TAAAAATAGGTAAAGGAGGCCGG - Intergenic
1026027951 7:66762292-66762314 TAGAAATAGGACATGGAGGCTGG + Intronic
1026154191 7:67812910-67812932 AGAAGCTAGGAGCAGGAGGCTGG - Intergenic
1026945104 7:74310959-74310981 TAAAAATAGGAGCTCGAGGCAGG - Intronic
1028463209 7:91119558-91119580 TCAAACTAAGAGAGGGAGGAAGG - Intronic
1028829707 7:95314060-95314082 TAAAAGCAGGTGAAGTAGGCTGG + Intronic
1029996160 7:105010528-105010550 AAAAACAAGGAAAAGGAGGTTGG + Intergenic
1030300382 7:107968552-107968574 TAAAAGTGGGAGAGGCAGGCAGG + Intronic
1030849877 7:114470797-114470819 AAAAACATGGAGAAGGAGGATGG - Intronic
1030921285 7:115391772-115391794 AAAAATTGGGAGAAGGAGGCGGG - Intergenic
1031264893 7:119569589-119569611 TAAAATTAGGAGAAGGAAAAAGG + Intergenic
1032059230 7:128709995-128710017 TGAACCCAGGAGATGGAGGCGGG - Intronic
1032253765 7:130280780-130280802 AAGAGCTAGGAGAAGCAGGCTGG - Intronic
1032523694 7:132563744-132563766 GAAAAGGAGGAGAAGGAGGAGGG - Intronic
1032594955 7:133230215-133230237 GAAAATTGGGAGAAGGAGACAGG + Intergenic
1033068526 7:138179994-138180016 GACAAGTAGGAGAAGGAGGCTGG - Intergenic
1033087047 7:138352405-138352427 TAAAGCTGGGAGAAATAGGCTGG - Intergenic
1033190938 7:139278473-139278495 AAAAAAAGGGAGAAGGAGGCTGG - Intronic
1033555619 7:142486457-142486479 AAACATTAGGAGAAGGAGGAGGG - Intergenic
1034053436 7:148008065-148008087 TAAAAATAGTAGGAGGAGGCCGG + Intronic
1034847804 7:154463501-154463523 TAAGAAAAGGAGAAGTAGGCTGG - Intronic
1035212953 7:157342245-157342267 TGACACTAGGAGGCGGAGGCTGG - Intronic
1036197843 8:6736146-6736168 TAAAGCTAGATGAAGAAGGCTGG - Intronic
1037024940 8:14023725-14023747 AAAAACTAGGAGAAGGAGCCAGG + Intergenic
1037051961 8:14384845-14384867 TAAAAATAATACAAGGAGGCTGG - Intronic
1037608014 8:20453771-20453793 GAAGAGGAGGAGAAGGAGGCTGG + Intergenic
1038414316 8:27382660-27382682 TAAAACTACTAGAAGAAAGCAGG - Intronic
1039105512 8:33985154-33985176 TAACACTAGGTGAAGTAGGAGGG - Intergenic
1039298742 8:36186335-36186357 TAAAGCTAGGAATGGGAGGCAGG - Intergenic
1039838141 8:41273913-41273935 TAAAGCAAGGAGAAGAAGGCAGG + Intronic
1040054047 8:43042063-43042085 TAAAAATTGGAGCAAGAGGCCGG + Intronic
1040741677 8:50583320-50583342 TAAACCTGGGAGGCGGAGGCTGG + Intronic
1040802567 8:51359096-51359118 GAAACCTAGCAGAAGGAGACAGG - Intronic
1042253646 8:66781322-66781344 TACTACTAGGATAAGGAGGAAGG - Intronic
1043387626 8:79764150-79764172 TAAATCAAAGAGAAGGAGGCAGG + Exonic
1043455577 8:80408864-80408886 AAAAGCGAGGAGGAGGAGGCAGG - Intergenic
1044121658 8:88404249-88404271 TAAAGATAAGAGAAGCAGGCTGG - Intergenic
1044319705 8:90788952-90788974 AAAAACCACGAGAAGGAGGGGGG - Intronic
1045440233 8:102201738-102201760 TAAGTGTGGGAGAAGGAGGCTGG - Intergenic
1045447448 8:102282087-102282109 TGAAACTGGGAGGTGGAGGCTGG + Intronic
1045641877 8:104260304-104260326 TAAATATAAAAGAAGGAGGCTGG - Intergenic
1045755701 8:105538713-105538735 TAAAACAATGAGATGGAGGCTGG + Intronic
1046186617 8:110729762-110729784 TAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1046261560 8:111775127-111775149 TGAAACTGGGAGACGGAGGTTGG - Intergenic
1046626445 8:116581551-116581573 TAAAACTAGGAGAATGAGGAAGG - Intergenic
1046906843 8:119582608-119582630 GAAAATTAAGAAAAGGAGGCAGG + Intronic
1047365237 8:124205211-124205233 TAAAAGTGGAAGAGGGAGGCAGG + Intergenic
1047696966 8:127413433-127413455 TACAGCTAGGTGAAGGGGGCAGG - Intergenic
1047850457 8:128851766-128851788 TAAAAGTAGAAGAGGGAGGTAGG + Intergenic
1047917100 8:129593955-129593977 TAAAGGTAGGAGGTGGAGGCAGG + Intergenic
1048085819 8:131178332-131178354 TAAAAAAAGTAGAAGGAGGCTGG + Intergenic
1048282313 8:133114417-133114439 CAGTACTAGGAGAGGGAGGCAGG - Intronic
1049024265 8:139977975-139977997 TTAAATTAGGAGTAGGAGGCTGG - Intronic
1049286435 8:141777954-141777976 TGGAACCAGGAGGAGGAGGCTGG + Intergenic
1050977620 9:11961616-11961638 TAAAACTATGAGAAGTAGGATGG + Intergenic
1051474493 9:17490093-17490115 TAGAAATAGGAAAAGTAGGCTGG + Intronic
1052630777 9:31035775-31035797 AAAAACTAGAACAATGAGGCCGG - Intergenic
1053322227 9:37109323-37109345 TAAAACTATTAGAAGAAAGCAGG + Intergenic
1053679623 9:40475789-40475811 GCAAACTAGGTGAAGGAGGAAGG - Intergenic
1053929617 9:43104118-43104140 GCAAACTAGGTGAAGGAGGAAGG - Intergenic
1054284098 9:63149156-63149178 GCAAACTAGGTGAAGGAGGAAGG + Intergenic
1054292704 9:63311325-63311347 GCAAACTAGGTGAAGGAGGAAGG - Intergenic
1054390722 9:64615800-64615822 GCAAACTAGGTGAAGGAGGAAGG - Intergenic
1054504999 9:65900509-65900531 GCAAACTAGGTGAAGGAGGAAGG + Intergenic
1054759596 9:68992677-68992699 TAAAAATAGGAAAATTAGGCAGG + Intronic
1054762042 9:69012755-69012777 TAAAACAGGCAGAAGGGGGCTGG + Exonic
1054952992 9:70873877-70873899 TAAAAATAGGAGAAGGAAGAAGG - Intronic
1055552660 9:77445660-77445682 TGAACCTAGGAGTCGGAGGCTGG + Intronic
1055897712 9:81198529-81198551 AAAAAGGAGGAGAAGGAGGAAGG + Intergenic
1056131577 9:83592481-83592503 CAAAATTAGTAGAAGTAGGCCGG + Intergenic
1057016622 9:91657862-91657884 GAAAACAAGGAGATGGAGGAGGG - Intronic
1057026532 9:91738230-91738252 GGAAACTATGAGAAGGAGGGCGG + Intronic
1057909065 9:99004252-99004274 GCAAACTTGGAGAAAGAGGCCGG + Intronic
1058815201 9:108676456-108676478 TAAAACAATGAAAATGAGGCCGG - Intergenic
1060009812 9:120033540-120033562 TAAAACTAGGAAAATTAGCCAGG + Intergenic
1061345554 9:130022153-130022175 TAAAAAGAAGAGAAAGAGGCTGG - Intronic
1062287526 9:135779645-135779667 TGGAACCAGGAGATGGAGGCAGG + Intronic
1186329252 X:8514688-8514710 TAAAAGTGGAAGAGGGAGGCAGG + Intergenic
1187363584 X:18649344-18649366 GAAAACTAGGAGAATGAGGTGGG - Intronic
1187872518 X:23776267-23776289 TAAAAATGGATGAAGGAGGCTGG + Intergenic
1187951368 X:24474171-24474193 AAAATCTAAGAAAAGGAGGCAGG - Intronic
1187983453 X:24784435-24784457 TAAAACTTGGAGGCTGAGGCGGG + Intronic
1188390014 X:29608528-29608550 TTAAAATAAGAGGAGGAGGCCGG + Intronic
1188696565 X:33199446-33199468 AAAAACAATGAGAAGGAAGCAGG + Intronic
1189033631 X:37474466-37474488 GCAAACAAGGATAAGGAGGCTGG + Intronic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1189781777 X:44521169-44521191 TAAAACGAGTATATGGAGGCTGG - Intergenic
1189814859 X:44814336-44814358 TAAAAGTAGGATAAGCAGGCTGG - Intergenic
1190087689 X:47409943-47409965 TAAAAAATGAAGAAGGAGGCTGG - Intronic
1190602793 X:52109410-52109432 GAATACTAGGACAGGGAGGCAGG - Intergenic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1191740284 X:64429746-64429768 TAAAACAAGGAAAAGGAAGCAGG + Intergenic
1191866038 X:65704650-65704672 AAAAACTATGTGGAGGAGGCTGG - Intronic
1192260120 X:69501145-69501167 TAAAGCCAGGGGATGGAGGCGGG - Intergenic
1193493049 X:82173348-82173370 TAAATCTCAGAGAAGGAGGCTGG + Intergenic
1193952447 X:87817191-87817213 TAAACCTGGGAGGAGGAGGATGG - Intergenic
1194683550 X:96883674-96883696 TAAAACTAGGAGCATCAGGCCGG - Intronic
1194864712 X:99051975-99051997 TAACACCATTAGAAGGAGGCTGG - Intergenic
1194973838 X:100373295-100373317 TAAAACTAGGAGAAGGAGGCTGG - Intronic
1195832971 X:109080516-109080538 TAAAACAAGGAGAAAGTGGAAGG - Intergenic
1196173193 X:112612422-112612444 TAAAATTAGGAAGAGGAAGCAGG + Intergenic
1196292286 X:113956998-113957020 TAAAAGTGGGAGAGGGAAGCAGG + Intergenic
1196329488 X:114453753-114453775 AAGAACTAGAAGAAGGAGGGAGG + Intergenic
1196838228 X:119833055-119833077 TGATGCTAGGGGAAGGAGGCAGG - Intergenic
1196847876 X:119910956-119910978 TAAAATTAGAAGAAAAAGGCCGG - Intronic
1197543782 X:127798646-127798668 TAAAAATACTGGAAGGAGGCTGG + Intergenic
1197858323 X:130942695-130942717 TAAAACAATGCAAAGGAGGCAGG - Intergenic
1198645615 X:138802680-138802702 AGCAACTAGGAAAAGGAGGCAGG - Intronic
1198797679 X:140416304-140416326 TGAAACAAGGAGAAGGAGCAGGG - Intergenic
1198806552 X:140500671-140500693 TAAAACAAGGAAGAGGAGGGAGG + Intergenic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1200761745 Y:7045111-7045133 TAACACTAGGATAAGGACACTGG - Intronic