ID: 1194978409

View in Genome Browser
Species Human (GRCh38)
Location X:100415581-100415603
Sequence TCCAAGTGGACCCCAAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194978406_1194978409 26 Left 1194978406 X:100415532-100415554 CCATTTGGGCTCTCAGCATTATT No data
Right 1194978409 X:100415581-100415603 TCCAAGTGGACCCCAAATGCTGG No data
1194978407_1194978409 2 Left 1194978407 X:100415556-100415578 CCTCAATCTTTTCATGTGAATTT No data
Right 1194978409 X:100415581-100415603 TCCAAGTGGACCCCAAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194978409 Original CRISPR TCCAAGTGGACCCCAAATGC TGG Intergenic
No off target data available for this crispr