ID: 1194985118

View in Genome Browser
Species Human (GRCh38)
Location X:100481774-100481796
Sequence TGTTAGATATATGACTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194985118_1194985122 10 Left 1194985118 X:100481774-100481796 CCTCCAAAGTCATATATCTAACA No data
Right 1194985122 X:100481807-100481829 CCTCTCCTCTGAGACAGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194985118 Original CRISPR TGTTAGATATATGACTTTGG AGG (reversed) Intergenic
No off target data available for this crispr