ID: 1194995648

View in Genome Browser
Species Human (GRCh38)
Location X:100588935-100588957
Sequence CAGAGCAATGAGGAGTGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194995641_1194995648 29 Left 1194995641 X:100588883-100588905 CCACAGTAATCAATAGATTCGTG 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1194995648 X:100588935-100588957 CAGAGCAATGAGGAGTGGTAGGG 0: 1
1: 0
2: 4
3: 21
4: 237
1194995643_1194995648 -2 Left 1194995643 X:100588914-100588936 CCTTCAACTTCTATATATTACCA 0: 1
1: 0
2: 1
3: 16
4: 177
Right 1194995648 X:100588935-100588957 CAGAGCAATGAGGAGTGGTAGGG 0: 1
1: 0
2: 4
3: 21
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194995648 Original CRISPR CAGAGCAATGAGGAGTGGTA GGG Intronic
900761157 1:4471784-4471806 CAGAGCAATGAAGCTTGGTGGGG + Intergenic
901233142 1:7652307-7652329 CAGAGCAAGCAGGAGAGGAAGGG - Intronic
901472526 1:9467622-9467644 CAGAAGAATGAGGAGAGGAAAGG + Intergenic
902228423 1:15011856-15011878 AAGAGGAAGGAGGAGTGGGAAGG + Intronic
903382758 1:22908358-22908380 CAGAGCCATGTGGAGTGACAGGG + Intronic
904083764 1:27888911-27888933 CAGAACAATGAGGATTAGCAGGG + Intergenic
904348844 1:29891931-29891953 CAGAGCAATCAGGAATGAGATGG - Intergenic
904619868 1:31768688-31768710 CAGAGCAATGAGTATTGCCAAGG - Intergenic
906669008 1:47641367-47641389 CAGAGCTATCAGGAGTGGCAGGG - Intergenic
906802398 1:48749545-48749567 CAGTTCATTGAGGAGGGGTAGGG - Intronic
907520575 1:55020846-55020868 CAGAGCACTGTGGAGGGGTCTGG + Intergenic
907860504 1:58348085-58348107 CAGAGCAATGAGGGAAGGTGAGG - Intronic
908249861 1:62256844-62256866 CAGAGCTATGAGGTGATGTATGG - Intronic
910241815 1:85094928-85094950 GAGAGCACTGGGGAGTGGTAGGG + Intronic
910981736 1:92965091-92965113 CAGAGGAAACAGGAGTGGCAGGG - Intergenic
912510001 1:110182922-110182944 CAGAGAAATGAGAAATGGGATGG + Intronic
913282217 1:117197312-117197334 GAGAGCAATGAGAAGGGGGAGGG - Intronic
913356427 1:117927981-117928003 CAGAGCAACTGTGAGTGGTAAGG - Intronic
913688166 1:121253611-121253633 CAGAGCACTGAGGACTGCAAGGG + Intronic
914149437 1:145026666-145026688 CAGAGCACTGAGGACTGCAAAGG - Intronic
914243080 1:145865591-145865613 CAGAGCAAAGAGGATTCTTAGGG + Intergenic
916128459 1:161591511-161591533 TGGAGCAAAGAGGAGTGGTGTGG + Intronic
916138375 1:161673342-161673364 TGGAGCAAAGAGGAGTGGTGTGG + Intronic
917775522 1:178330063-178330085 CAGAGCCATTAGTAGGGGTAGGG + Intronic
918486170 1:185030645-185030667 CAGAGCACTGAGGATTTTTAGGG + Intergenic
918978629 1:191525509-191525531 CAGAACACGGAGGACTGGTAAGG + Intergenic
920475488 1:206272110-206272132 CAGAGCACTGAGGACTGCAAGGG + Intronic
923554581 1:234990692-234990714 CAGAGCAATGGAGAGTGTTATGG - Intergenic
924657337 1:245984899-245984921 CAGAGCAAGGAGAAGTCGGATGG - Intronic
1063147622 10:3310199-3310221 AAGAGCAATTAGGAGAGGAAAGG + Intergenic
1063821152 10:9837736-9837758 CATAGAATTGAGGAGAGGTAGGG - Intergenic
1064949984 10:20837402-20837424 CACAGAAATGAGGAGGGTTAGGG - Intronic
1066648578 10:37634941-37634963 CAGAAGAATGAGGGGTGGTGAGG + Intergenic
1067031452 10:42880627-42880649 CAGAAGAATGAGGGGTGGTGAGG + Intergenic
1068870925 10:61943411-61943433 AAGAACAATGAGGAGTTGGAAGG - Intronic
1069596661 10:69676355-69676377 GAGAGCAAGGTGGAGTGGGAAGG + Intergenic
1070451651 10:76564388-76564410 GAGAGCAGTGAGGGGTGGTGTGG - Intergenic
1073138470 10:101232423-101232445 CAGAGCAATGAGGTATGTTTTGG + Intergenic
1074464113 10:113666831-113666853 CAGAGCAATGTGGGGTGGTGTGG - Intergenic
1075136602 10:119791995-119792017 CAGAGCACTGGGGAGAGGGACGG + Exonic
1077913737 11:6597220-6597242 CAGAGCAATCAGCAGTGATTAGG - Exonic
1078967961 11:16369754-16369776 CAGAGAATTGAAGAGTGATATGG - Intronic
1079633173 11:22702818-22702840 CAGAGCAAGGAGAAGAGATAGGG + Intronic
1081740276 11:45434706-45434728 CAGAGCAATCAGGGGTGAGATGG + Intergenic
1083153146 11:60806180-60806202 CACAGCCATGAGGGGTGGTGAGG - Intergenic
1084004463 11:66315691-66315713 GAGAGCACTGAGGAGTGGTAGGG + Exonic
1085098407 11:73779582-73779604 CAGACCAATGGGGAGAGGCAAGG + Intergenic
1085217564 11:74845566-74845588 CGGAGCAATGGGGAGAGGTGTGG + Intronic
1086506812 11:87513702-87513724 CAGAGCGTTGGAGAGTGGTAAGG + Intergenic
1086944205 11:92829000-92829022 CAGATGAGTGAGGAGAGGTAGGG - Intronic
1088187764 11:107192574-107192596 CAGAGAAAAGAGGATGGGTATGG - Intergenic
1088621810 11:111692482-111692504 CAGAGCGAATTGGAGTGGTAAGG + Intronic
1089025793 11:115268568-115268590 CAGAGCACTGAGCTGGGGTAGGG - Intronic
1090090574 11:123693852-123693874 CAGAGCAATGAGCAATAATAAGG - Intergenic
1090655258 11:128838389-128838411 GACAGCAATGAGGAGTTGGAAGG - Intronic
1091240149 11:134046697-134046719 CAGAGCGCTGAGGAGTAGCATGG - Intergenic
1091652885 12:2322969-2322991 CACAGCTATGGGGAGTGGTGAGG - Intronic
1096198496 12:49664461-49664483 TGGAGGAATGCGGAGTGGTAGGG + Intronic
1098853571 12:75626434-75626456 CAGTGCATTGAAGACTGGTAAGG + Intergenic
1099993533 12:89752567-89752589 CAGAGCTGTGAGCAGTGGTGAGG - Intergenic
1102948744 12:117013473-117013495 AAGAGCAATGAGTAATGGTACGG + Intronic
1104264886 12:127222210-127222232 CAGAAGGATGAGGAGTGGGAAGG - Intergenic
1104413002 12:128574841-128574863 TAAAGTAATGAGGAGTGGCAAGG - Intronic
1107160293 13:37217835-37217857 CAGAGCACAGAGGAGTTTTAGGG - Intergenic
1110261280 13:73487865-73487887 AAGAGCAATGAGGAGAGGTGAGG + Intergenic
1113243052 13:108361433-108361455 CAGAGCAAAGAGGAATTGTCAGG - Intergenic
1113998065 14:16104393-16104415 CAGAGTACAGAGGAGTGGAATGG - Intergenic
1114666682 14:24381553-24381575 CAGAGCAATGAGTAATGGTGGGG + Intergenic
1116893618 14:50293837-50293859 CTGAGCAGTGAGGTGTGGTTGGG - Intronic
1120300199 14:82696153-82696175 TAGGTCAATGAGGAGTGGTATGG + Intergenic
1122794606 14:104199920-104199942 AAGATCAATGAGGAATGGCACGG - Intergenic
1125798328 15:42421343-42421365 CAGGGCAGAGAGGAGTGGCAGGG + Intronic
1126379681 15:48033462-48033484 CAGAGCACAGAGGAGTTGTAGGG + Intergenic
1126496989 15:49302445-49302467 AAGAGCCATGAGAAGTGCTATGG + Intronic
1126986462 15:54316241-54316263 GAGAACAATTAGGATTGGTATGG - Intronic
1129198932 15:73987122-73987144 GAGAGCAATGAGCAGTGGTGGGG + Intronic
1129411979 15:75355347-75355369 CAGAGCCTTGAGGACTGGGATGG - Exonic
1129847314 15:78773929-78773951 CAGTGCCAGGAGGCGTGGTAGGG + Intronic
1130254568 15:82319922-82319944 CAGTGCCAGGAGGCGTGGTAGGG - Intergenic
1130600397 15:85270048-85270070 CAGTGCCAGGAGGCGTGGTAGGG + Intergenic
1130766855 15:86879503-86879525 GAGGGCAAGGAGGAGTGGGAGGG - Intronic
1130849215 15:87777598-87777620 CAGAGAAATCAGCTGTGGTATGG + Intergenic
1134237738 16:12480766-12480788 CTGAGCTCTGAGGAGTGGGAGGG + Intronic
1134504478 16:14793863-14793885 CACGGCAATCAGGAGTGGCAAGG - Intronic
1134576093 16:15335046-15335068 CACGGCAATCAGGAGTGGCAAGG + Intergenic
1136056324 16:27692550-27692572 CAGCACACTGAGGAGTGGCAAGG - Intronic
1138223331 16:55271694-55271716 CAGAGCAAAGAGGACTTTTAGGG + Intergenic
1139034263 16:62924134-62924156 CACAGCCATGAGGAGTGTCAAGG - Intergenic
1140211160 16:72971672-72971694 CAGTGCAAGCAGGAGTGGAAAGG - Intronic
1142921844 17:3195236-3195258 CCTTGCAATGAGGTGTGGTAAGG - Intergenic
1143419628 17:6778628-6778650 GAGAGCTTTAAGGAGTGGTAGGG + Intronic
1143633863 17:8153280-8153302 CAGAGAAATGTGGGGTGGCAAGG + Intronic
1143714188 17:8755408-8755430 CAGAGTAAAGAGGAGAAGTAGGG + Intronic
1145245968 17:21269547-21269569 CAGAGCCATCAGTAGTGGCAAGG - Intergenic
1147569306 17:41558295-41558317 GAAAGCAATGAAGGGTGGTAGGG - Intergenic
1147738724 17:42657941-42657963 CAGAGGAATCAGGAGAGGGAAGG - Intergenic
1147858479 17:43501363-43501385 GAGAGCAGTGGGCAGTGGTAGGG + Intronic
1149029608 17:52068051-52068073 CAGAGACATGAGGATTGGGAGGG + Intronic
1158052557 18:53241145-53241167 CAGAGAGATGAGGAGGTGTAAGG + Intronic
1161131550 19:2592718-2592740 CAGAGCAACAAGGAGAGGGAAGG + Intronic
1161393265 19:4032146-4032168 CAGGCCAATAAGGGGTGGTAGGG + Intronic
1162672207 19:12266563-12266585 CAGTGCAGAGAGGAGAGGTAAGG + Intronic
1164183168 19:22837585-22837607 CAGAACAATGAGCAGTGTGACGG - Intergenic
1164716665 19:30396099-30396121 CAGAGCAGAGAGGAGTTTTAGGG - Intronic
1165564095 19:36708598-36708620 CAGAGCAAAGAGGATTTTTAGGG - Intronic
1165984109 19:39752300-39752322 AAGAGCAAGGAAGAGTGGGAAGG + Intergenic
1168639333 19:58020298-58020320 CAGGGCAATGGGGAGGGGTGAGG + Intergenic
925964359 2:9050006-9050028 CAGAGGCATGAGGTGTGATATGG + Intergenic
925986989 2:9224677-9224699 CTGATAAATGAGGAGTGTTAGGG - Intronic
926406158 2:12555094-12555116 CAGGGCAATGAGCAGTGCTAGGG - Intergenic
927137177 2:20105513-20105535 GAGAGCAATGAGGAGTGGGCAGG - Intergenic
928839730 2:35590704-35590726 CAGGACAATTAGGAGAGGTAGGG - Intergenic
929828540 2:45329274-45329296 GAGAGCAATGAGGATGGGAATGG - Intergenic
930641769 2:53860208-53860230 CAGAGCAAGGTGGAGTGGTAAGG + Intergenic
931799767 2:65747434-65747456 CAAAGCAAGGGGGAGTGGGACGG - Intergenic
933313452 2:80688426-80688448 GAGAGAAATGAGGAGTGATTTGG + Intergenic
935328979 2:101962431-101962453 CAGAGCAATGAAGAGGGCTGCGG + Intergenic
935733804 2:106089829-106089851 CAGAGCAAAGAGTGGGGGTAGGG + Intergenic
937129133 2:119494212-119494234 CAGAGAAAGGAAGAGTGGTGAGG + Intronic
937836064 2:126471374-126471396 CAGAGGAATGAGGAGTGGAAAGG + Intergenic
939601816 2:144201784-144201806 GAGAGCATTGAGGGGTGGGATGG - Intronic
940533897 2:154913911-154913933 CAGAGAAATGATCAGTGGTGAGG + Intergenic
941918747 2:170828917-170828939 CAGAGAGATGAGGAGGGGTGAGG - Intronic
943840123 2:192569890-192569912 CAGAGCAAAGAGGATTTATAGGG - Intergenic
945388863 2:209239245-209239267 CAAAGCAATGAGGAGAGGATAGG + Intergenic
946779044 2:223174039-223174061 CAGAGCTGTGATGAGTGGAAAGG - Intronic
948714571 2:239852400-239852422 GAAAGCAATGAGGAGTGCTGTGG + Intergenic
948747561 2:240107440-240107462 CAGAGGAATGGGGAGAGGTTGGG - Intergenic
1168835270 20:873431-873453 CAGAGCGATGAGGGGAGGTTGGG - Intronic
1170255944 20:14343192-14343214 CAGGGCACTGGGGAGTGGCAAGG - Intronic
1170383935 20:15795447-15795469 CAGAGCCAAGGGGAGTGGGAGGG + Intronic
1170595256 20:17800616-17800638 CAGAGCACTGAGGACAGGAATGG + Intergenic
1170782941 20:19441800-19441822 CAGAGCACTGAGGATTTTTAGGG - Intronic
1171436293 20:25127154-25127176 CACAGCAATGAAGTGTGGCAAGG + Intergenic
1172489834 20:35327152-35327174 CACAGCAATGAAGAGTGAAAGGG + Intronic
1175519728 20:59592616-59592638 CAGAGCACAGAGGATTTGTAGGG - Intronic
1176128727 20:63487345-63487367 CAGAGCAGGGAGGGGTGGAAAGG + Intergenic
1176757040 21:10733270-10733292 CAGAGCAGAGAGGAGTGGAGTGG - Intergenic
1177370668 21:20199156-20199178 CAGATTAATGAGGAATGGGAAGG + Intergenic
1178594962 21:33945025-33945047 CAGAGCACGGAGGATTTGTAGGG + Intergenic
1180175191 21:46083846-46083868 CAGAGCAGGCAGGAGTGGGAGGG + Intergenic
1182736153 22:32533255-32533277 CAGAGCATTGAGGATTTGGAAGG - Intronic
1183732282 22:39625310-39625332 CAAAGCCATGAGGAGTGGGCTGG + Intronic
1184383442 22:44160772-44160794 CAGAGCAATGAGGCTTGGAAGGG + Intronic
949356600 3:3187055-3187077 CAGAGCAATGAGCAGTTGGTAGG + Intergenic
950016339 3:9757405-9757427 AAATGCAGTGAGGAGTGGTAGGG + Exonic
955393289 3:58536597-58536619 CAGAGCAAGGAAAAGAGGTAAGG - Intronic
956360122 3:68438615-68438637 TAGAGCAATGCTGAGTGGAAAGG - Intronic
956583494 3:70839660-70839682 ACGAGCAATGAGCAGTGGTGGGG + Intergenic
957134093 3:76262830-76262852 CAGAGCAATTATGCTTGGTAGGG + Intronic
958635925 3:96746691-96746713 AAGAGGAAAGAGGAGTGCTATGG + Intergenic
959118445 3:102205804-102205826 AAGAGGAAGGAGGAGTGGGAAGG - Intronic
961018325 3:123483884-123483906 CAGAGCAACGAGGACTGTGATGG + Intergenic
961148222 3:124613259-124613281 CGGAACAATCAGGAGAGGTATGG - Intronic
961626460 3:128267198-128267220 CAGAGAAGTCAGTAGTGGTAAGG + Intronic
962306048 3:134287285-134287307 CAGTGCAATGAGCAGGGGGATGG - Intergenic
964527914 3:157634904-157634926 CAGAGCCAAGAGGAGGGATAAGG + Intronic
965414246 3:168372517-168372539 CTGAGAAATGAGGAGTGTTTTGG + Intergenic
966441168 3:179946076-179946098 CAGAGCAATGAAGAGAGGTAAGG - Intronic
966473606 3:180319813-180319835 CTGGGCAAGGAGGAGTGGGAAGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967305113 3:188052144-188052166 CAAGGCAATGGGGAGTGGGAGGG + Intergenic
967690922 3:192472645-192472667 CAGAGGAATGAAGAGTAGGAAGG + Intronic
967808954 3:193739260-193739282 CAGAGCACAGAGGATTGTTAGGG - Intergenic
968464567 4:744129-744151 CACAGCCATGAGGCGTGGTTAGG + Intronic
969081025 4:4618189-4618211 CAAAGCCATGGGGAGTGGCATGG + Intergenic
970104362 4:12564039-12564061 AAGAGCAATGATCAGTGGTGAGG - Intergenic
972615813 4:40696943-40696965 CAGAGCACTGGGGGGTGGTAGGG + Intergenic
976114222 4:81709954-81709976 CAGTACCCTGAGGAGTGGTAAGG - Intronic
977247187 4:94646610-94646632 CAGTGCAAAAAGGAGAGGTAAGG + Intronic
977327244 4:95591194-95591216 TAAAGCAATGAGAAGTGGTGTGG - Intergenic
979087719 4:116434877-116434899 CAGAGCAATCAGGAATGAGAAGG - Intergenic
979198053 4:117943239-117943261 CAAAGAATTGAAGAGTGGTAGGG - Intergenic
979663614 4:123286832-123286854 CAAAGCAGTGAGGAGTTGAAAGG + Intronic
979977033 4:127209664-127209686 CTAAGCAATGAGGAGAGGCAGGG + Intergenic
981225999 4:142294932-142294954 CTGAGGAAAGAGGAGTGGTGTGG + Intronic
981517672 4:145627551-145627573 TTGAGCAATGAGAATTGGTAAGG + Intronic
981948117 4:150373807-150373829 CAGGGAAAAGAGGAGAGGTAAGG - Intronic
982828984 4:160036552-160036574 CAAATCAATCAGGAGTTGTATGG - Intergenic
986748974 5:10768448-10768470 CAGAGAAATGGGAAGTGGTAAGG + Intergenic
986776648 5:11021237-11021259 GAGAGCTTTGAGGAGTGGTTTGG - Intronic
991650286 5:68845635-68845657 CAAAGCAAGGAGGAGAGGGAAGG + Intergenic
992168124 5:74074712-74074734 CCAAGGAATGAGGAGTAGTAAGG + Intergenic
992757173 5:79918620-79918642 AAAAGCAATGAGGAGAGGAAAGG + Intergenic
992813989 5:80418252-80418274 AAGAGCAAAGAGGAGGGGAAAGG - Intronic
993096010 5:83478975-83478997 CAGAGAACAGAGGAGTGCTAAGG + Intronic
993761168 5:91799391-91799413 CAGAGCAAAGGGGCGTGGGAGGG + Intergenic
995253549 5:110019885-110019907 CAGAGCACTGAGAAGGAGTATGG + Intergenic
995332399 5:110959755-110959777 AAGAGAAATGAGGAGTGTCAAGG + Intergenic
997834001 5:137177784-137177806 GAGAGAAATGAGGAGTGGGAGGG + Intronic
998205499 5:140154335-140154357 CAGAGCAAGCAGGAGTGGGGAGG - Intergenic
999133292 5:149300548-149300570 CAGAGACTTGAGGAATGGTAGGG + Intronic
999889587 5:155962641-155962663 CAGAGAAATTAGGAGGGCTATGG + Intronic
1000918496 5:167110470-167110492 CAGAGAACTGGGGAGTGGGAAGG - Intergenic
1001202511 5:169731166-169731188 CACAGCATTGAGAAGTGGCAAGG - Intronic
1001555035 5:172631340-172631362 CAAAGCAAACAGGAGTGGCAGGG + Intergenic
1001773818 5:174314200-174314222 CTGAGCACTGAGGAGGGGAAAGG - Intergenic
1002108438 5:176891851-176891873 GAGAGCAATCATTAGTGGTATGG - Intronic
1003056718 6:2827413-2827435 CATAGCACTGAGGAGTGAAATGG - Intergenic
1003410089 6:5854452-5854474 GAGAGCAAAGAGGGGTGGTCTGG + Intergenic
1007875582 6:45097432-45097454 CAGAGGAAAGAGGTGTGATAAGG + Intronic
1008013714 6:46494121-46494143 CAGAGCACAGAGGAGTTTTAAGG - Intergenic
1012627963 6:101427306-101427328 CAGAGCAATGAGAATGGGGATGG - Intronic
1014158739 6:118141832-118141854 CAGTGAAACGAGGACTGGTAGGG - Intronic
1014166089 6:118226704-118226726 AAGAGTAGAGAGGAGTGGTAGGG + Intronic
1014796999 6:125736954-125736976 AAGAGCAATGAGGGTTGGCATGG - Intergenic
1017031063 6:150222577-150222599 CAGAGCACGGAGGATTGTTAGGG - Intronic
1021215742 7:17913272-17913294 CAGTGCACTGGGGAGTGGTGGGG - Intronic
1021927362 7:25546250-25546272 CAGGGCAAGGAGGAGGGGTTGGG + Intergenic
1026099336 7:67371757-67371779 CAGAGCAATTACAAGTGGTTAGG + Intergenic
1028614856 7:92754987-92755009 GAGAGCAGAGAAGAGTGGTAGGG - Intronic
1030333269 7:108295871-108295893 CAGGGCACAGAGGAGTGGTGAGG + Intronic
1030444242 7:109628807-109628829 CAGAGCACAGAGGAGTTTTAGGG - Intergenic
1030664312 7:112257658-112257680 TAGAGTAATAGGGAGTGGTAAGG + Intronic
1031080862 7:117255690-117255712 CTGAGCACTGAGTAGTGGTTTGG + Intergenic
1033046487 7:137967098-137967120 CAGGGCAAAGAGGAGTGGGAAGG - Intronic
1033226580 7:139567758-139567780 GAGAGAATTGAGGAGAGGTAAGG - Exonic
1033467822 7:141612334-141612356 CAGAGCACAGAGGATTGTTAGGG + Intronic
1034815518 7:154169074-154169096 CAGCGCAATCAGAAGGGGTATGG - Intronic
1036658132 8:10690817-10690839 GAGAGGAATGAGGAGGGGAAGGG - Intronic
1037424850 8:18744402-18744424 TAGAGTTATGAGTAGTGGTATGG - Intronic
1037505319 8:19523774-19523796 CAGGGTAATGGGGAGTGGCAAGG + Intronic
1037887520 8:22602614-22602636 CAGAGCCATCAGGAGGGGCAGGG - Exonic
1037928462 8:22863609-22863631 CAGAGCAGTGAGAAGGGGTGGGG - Intronic
1039372826 8:37003952-37003974 CAGAACAATGAGCAGAGGCAAGG + Intergenic
1040085996 8:43342407-43342429 CAGAGCACTGACGTGTGATAGGG + Intergenic
1041256336 8:55982615-55982637 CACAGCAAGGAGGAGTGTTCGGG - Intronic
1041413202 8:57579218-57579240 CACAGCTATGAGGAGTGGGGCGG + Intergenic
1042777929 8:72455304-72455326 CAGAGCAATCAGGAAAGGGAAGG - Intergenic
1045900913 8:107278937-107278959 CAGAGCCATGATGAGTCTTACGG - Intronic
1048577653 8:135705838-135705860 AAAAGCAATGAGGAGTGGCATGG + Intergenic
1048782227 8:138014876-138014898 CAGGGCAATGAGGAGCAGTCAGG + Intergenic
1050040045 9:1480640-1480662 CAGACCAATAATGAGTAGTAAGG - Intergenic
1051489049 9:17640677-17640699 CCGAGAAATGAGAAGTGTTATGG - Intronic
1052292089 9:26853631-26853653 CTGAGCAATGACGAGTGAAATGG + Intronic
1053019768 9:34686800-34686822 CAGATCTCTGAGGAGTGGTGTGG - Intergenic
1054818268 9:69496534-69496556 CAGAACAATGAGGAGAGAGAGGG - Intronic
1054863469 9:69976208-69976230 CAGAGAAGTGAGGAGGGGTGAGG + Intergenic
1055923334 9:81484915-81484937 CAAAGCAATGTGGAGAGGTAGGG + Intergenic
1056023835 9:82470143-82470165 CTGAGGACTGAGTAGTGGTAGGG + Intergenic
1056270821 9:84946571-84946593 GACAGCAATGAGGGGTGGTCAGG + Intronic
1056502463 9:87223374-87223396 CACAGCAATGAGGAAGGGCACGG + Intergenic
1056672299 9:88640515-88640537 CAGACCAGTGAGGAATGGTTTGG + Intergenic
1056795875 9:89658598-89658620 CGGAGCAATGAGGAGAGGACTGG - Intergenic
1057011127 9:91602309-91602331 CAGAGCACAGAGGAGTTTTAAGG - Intronic
1058042183 9:100314412-100314434 CAGACCAATAATGAGTAGTATGG - Intronic
1060843978 9:126819969-126819991 CAGAGAAATGAAGAGAGTTAGGG - Intronic
1062089539 9:134667971-134667993 CAGAGCTGTGAGGGGTGGGAAGG + Intronic
1203347092 Un_KI270442v1:42668-42690 CAGAGCAGAGAGGAGTGGAGTGG + Intergenic
1187815030 X:23222334-23222356 TAAAGCAATAGGGAGTGGTAGGG - Intergenic
1188565151 X:31518645-31518667 CAGAGCCATGATGAGGGGTGGGG + Intronic
1189499751 X:41545417-41545439 CACAGCAATGAGGAATGGACAGG - Intronic
1190144154 X:47875147-47875169 CAGAGCAAGGAGGAGCAGGAGGG + Intronic
1191952182 X:66604514-66604536 CAGAGCAATTAGGAATGGCAGGG + Intronic
1192212035 X:69133811-69133833 TGGAGCAATGAGGTGTGGTCTGG - Intergenic
1192986042 X:76399213-76399235 CAGAGCACTGAGGCTTAGTAAGG - Intergenic
1194995648 X:100588935-100588957 CAGAGCAATGAGGAGTGGTAGGG + Intronic
1195904567 X:109830679-109830701 CAGAGCATAGAGGAGTGGAAAGG + Intergenic
1197130541 X:123000862-123000884 TATAGCAATAAGGAGTGGTGAGG + Intergenic
1199980834 X:152919605-152919627 CAGAGGACTGAGGAGGGGCAAGG - Intronic
1200032565 X:153308032-153308054 CAAAGCAATCAGGAGTAGCATGG - Intergenic
1200411518 Y:2866575-2866597 CTCAGCAGTGAGGAGTGGGAGGG + Intronic
1201121000 Y:10873462-10873484 CAGAGCAATGTGGAGTTGAGTGG - Intergenic