ID: 1194996418

View in Genome Browser
Species Human (GRCh38)
Location X:100596025-100596047
Sequence AAGATTAAGGCAAAGGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 1, 2: 0, 3: 35, 4: 376}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194996413_1194996418 10 Left 1194996413 X:100595992-100596014 CCTGAAGTGATATAATAGGATTT 0: 1
1: 0
2: 0
3: 18
4: 198
Right 1194996418 X:100596025-100596047 AAGATTAAGGCAAAGGAGGCGGG 0: 1
1: 1
2: 0
3: 35
4: 376
1194996411_1194996418 27 Left 1194996411 X:100595975-100595997 CCACTCAGCAATGAGAACCTGAA 0: 1
1: 0
2: 0
3: 18
4: 252
Right 1194996418 X:100596025-100596047 AAGATTAAGGCAAAGGAGGCGGG 0: 1
1: 1
2: 0
3: 35
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194996418 Original CRISPR AAGATTAAGGCAAAGGAGGC GGG Intronic
900111561 1:1008387-1008409 AATATTAAGTAAAAGGAAGCAGG - Intergenic
900375775 1:2353986-2354008 AAGATAAAGACTAAAGAGGCCGG + Intronic
901144334 1:7054940-7054962 AAGATGAAGGGGAAGTAGGCTGG + Intronic
902241573 1:15093615-15093637 AAGATAAAGATAAATGAGGCAGG + Intronic
903156777 1:21450363-21450385 AAGATGAAGCCACAGAAGGCAGG - Intronic
903455014 1:23481611-23481633 AATCTGAAGGCAAAGGAGGATGG + Intronic
904555546 1:31360696-31360718 AAGATGAAGGCTCAGGAGGAGGG - Intronic
904930853 1:34086536-34086558 ATCATTAAGGCCAAGGAGACTGG + Intronic
906208449 1:43999345-43999367 AAGATTGAGGCACAGCGGGCGGG - Intronic
906451696 1:45954864-45954886 AAGGTTAAGGCAAATGAAGCTGG + Intronic
906748993 1:48242158-48242180 CAGACTGAGGCAAATGAGGCTGG - Intronic
906884700 1:49631690-49631712 AAGACTAAGGGAAAGGAAGCAGG + Intronic
907067825 1:51503337-51503359 AAGAAAAAAGCAAAGTAGGCTGG + Intronic
907288443 1:53397029-53397051 ATGAATAAGACAAAGGAGCCGGG + Intergenic
908324601 1:63011272-63011294 ATGTTTAAGCCATAGGAGGCAGG - Intergenic
908621525 1:65986582-65986604 CAGAATAAGACAAAGGAGGAGGG - Intronic
909031984 1:70552995-70553017 AAGTTTAAGACAAAGGTGGTTGG - Intergenic
911441621 1:97934237-97934259 AAGATTGGGGGAAAGGAGACTGG - Intergenic
911763289 1:101641514-101641536 AAGATTAAAGCAAACTAGGTAGG - Intergenic
912191573 1:107347017-107347039 AAGAACAAGGCAAAGCAAGCAGG + Intronic
912895972 1:113589471-113589493 AAGGTTAGGGCAAAGGAATCAGG + Intronic
913539336 1:119803839-119803861 ACATTTTAGGCAAAGGAGGCAGG + Intronic
913963596 1:143357042-143357064 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914057956 1:144182631-144182653 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914121190 1:144783734-144783756 AAAAATAAGGAAAGGGAGGCTGG + Intergenic
914459542 1:147870397-147870419 AAGAATAAGGCTTAGGAAGCTGG + Intergenic
916410835 1:164545476-164545498 AAGATGGAGGAAAAGAAGGCTGG + Intergenic
917015634 1:170528522-170528544 AAGAGTCAGGCAAAGGAGCAGGG + Intergenic
919562437 1:199138529-199138551 AAGATAACGGTCAAGGAGGCAGG - Intergenic
919991340 1:202710115-202710137 AAGTTTGAGGCCAAGGGGGCCGG - Intronic
920132487 1:203743242-203743264 AATTGTAAGGCAAAGGAAGCAGG - Exonic
920264164 1:204709434-204709456 AAGATGAAGGCTAAGGAAGGAGG - Intergenic
921112663 1:212054290-212054312 AAGAACAAGGAAAAGGAGACTGG - Intronic
921171084 1:212550310-212550332 AAGAGGAAGGCAAGGGATGCTGG - Intergenic
921279860 1:213555853-213555875 AAGATGAAGGAAAAGGAGCCAGG - Intergenic
922338135 1:224634285-224634307 AAGAATAAGAAAAAAGAGGCCGG + Intronic
923158766 1:231300089-231300111 AACATTAAGGCCAGGGAGGAAGG - Intergenic
923259546 1:232255039-232255061 AACATTAATCCAAAGGAGGTTGG - Intergenic
923455786 1:234164171-234164193 AAGAGAAAAGCAAGGGAGGCAGG - Intronic
923656774 1:235923824-235923846 CAGGTTAAGTCAAATGAGGCTGG + Intergenic
923737251 1:236622185-236622207 TAGATTATGGCAAAGGTGACAGG + Intergenic
924544845 1:245016802-245016824 AAGAATAAGGCAAGGTAGGCAGG + Intronic
1063661653 10:8038269-8038291 AAGATAAATGAAAAGGAGGGTGG - Intergenic
1063690741 10:8284739-8284761 AAGATTAAGCCAAGGAAGGATGG - Intergenic
1063951520 10:11227439-11227461 AAAGTCAAGGCAAAGGAGGATGG + Intronic
1064729245 10:18312760-18312782 AAAATACAGGCAAAGGAGACAGG - Intronic
1064768475 10:18698785-18698807 AAGGTTAAGGGAAAGCAAGCAGG - Intergenic
1064990488 10:21252657-21252679 AAAAATGAGGCAGAGGAGGCTGG + Intergenic
1065595460 10:27306472-27306494 AAAATGGAGGCCAAGGAGGCTGG + Intergenic
1067258254 10:44663984-44664006 AGGATAAAGGCAAAGGAGTAGGG + Intergenic
1067660827 10:48235178-48235200 AATACTAAAGCTAAGGAGGCTGG - Intronic
1068475627 10:57520771-57520793 AAGATAAAGAGAAAGGAAGCAGG + Intergenic
1068513791 10:58000674-58000696 AAGAAAGAGGAAAAGGAGGCAGG + Intergenic
1068571895 10:58638923-58638945 AAGATGAAAGCAAACGAGGGAGG - Intronic
1069080581 10:64084250-64084272 TACATAAAGGCAAAGGAGGATGG + Intergenic
1071779122 10:88823266-88823288 AAGAATAAGGTAAGGGAGGGTGG - Exonic
1071901685 10:90127348-90127370 AAGATTAAGGCAAAGTTTACTGG - Intergenic
1072421990 10:95297010-95297032 AGGAACAGGGCAAAGGAGGCAGG + Intergenic
1072781770 10:98256397-98256419 AACATGAGGGCAGAGGAGGCAGG - Intronic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1074070902 10:110068290-110068312 AAGATTCAGAGAAAGGAGGGGGG - Intronic
1075651198 10:124129184-124129206 AAGATAATGGCAAAGGAAGGGGG - Intergenic
1076124693 10:127964465-127964487 TTGATAAAAGCAAAGGAGGCCGG - Intronic
1076980956 11:204484-204506 CAGAGTCAGGCAAAGCAGGCAGG - Exonic
1077101635 11:825041-825063 AAGATTAAGGCACAGGTGCGCGG - Exonic
1077681268 11:4242743-4242765 AATATGGAGGCACAGGAGGCAGG + Intergenic
1078215315 11:9306928-9306950 AAGATGAAGGGAAAGGAGCAAGG - Intronic
1080551857 11:33379296-33379318 AATATTCAAGCAAAAGAGGCTGG - Intergenic
1080671423 11:34382824-34382846 AAGATTAAGGCACCAGAGGCAGG - Intergenic
1081503159 11:43687239-43687261 GAGATTAAGGTTAGGGAGGCAGG + Intronic
1084071085 11:66735352-66735374 AAAATTAAGGAGAAGGGGGCTGG + Intergenic
1085199796 11:74694962-74694984 AAGATTAGGGCTGTGGAGGCTGG + Intergenic
1086373560 11:86178103-86178125 AAGATTAGGGCAACATAGGCTGG + Intergenic
1088548074 11:110981722-110981744 AAGAACAAGGCAGAAGAGGCAGG + Intergenic
1088548109 11:110982017-110982039 GAGAGGATGGCAAAGGAGGCTGG + Intergenic
1089076896 11:115745560-115745582 AAGATTACAGGAAAGCAGGCAGG + Intergenic
1089433241 11:118438750-118438772 ACGATTAAAAAAAAGGAGGCAGG - Intronic
1090026936 11:123175617-123175639 AAGATAAAGGAAAAGCAAGCTGG - Intronic
1090613836 11:128496834-128496856 AAGGTTAATGCAAAGAAGGGAGG + Intronic
1090696478 11:129248534-129248556 TAGCTTAAGTAAAAGGAGGCTGG - Intronic
1091476559 12:779695-779717 AAAATTAAGGGAAAGGAGCCAGG - Intronic
1091880333 12:3972127-3972149 ATAAATAAGACAAAGGAGGCCGG - Intergenic
1095694476 12:45129192-45129214 AAGAAAAAAGAAAAGGAGGCCGG + Intergenic
1095710969 12:45287623-45287645 GAGAATAAGGAAAAGGAGTCAGG + Intronic
1096337878 12:50771299-50771321 AAGAGTAAAGCAAAATAGGCTGG - Intronic
1096509977 12:52122263-52122285 AAGGTGAAGGTGAAGGAGGCTGG + Intergenic
1096530168 12:52237401-52237423 AAGAGTAGGGGAAGGGAGGCAGG + Intronic
1097008804 12:55938110-55938132 AGGAATAAGGGAAAGGAGGATGG - Intronic
1098946004 12:76590214-76590236 AAGAATAAGGCAAAGGTGATAGG + Intergenic
1099923367 12:88986274-88986296 AGGATTAAGGCAAAGATGGAAGG - Intergenic
1100519350 12:95358355-95358377 ATTATTAAGGCAAAGGAAGCTGG + Intergenic
1100978157 12:100143067-100143089 AGGATTAAGGCCAAGAAGGATGG - Intergenic
1101282385 12:103271691-103271713 AAGAGTAAGGCCAAGGACACAGG + Intronic
1101900011 12:108784924-108784946 AAGAGGCAGGCAGAGGAGGCAGG - Exonic
1102991980 12:117322251-117322273 AAGAGGAAGGGAAAGGAGGGAGG - Intronic
1103194683 12:119033139-119033161 AAAATTAAAACAAAGGAGGAAGG - Intronic
1104146152 12:126035747-126035769 AAGATTAATATAAAGGAGGCAGG - Intergenic
1105632985 13:22189700-22189722 AAGAGTTAAGCAAAGGAGCCAGG + Intergenic
1106225828 13:27786314-27786336 GGGATTAAGCCAAAGGAGGAGGG - Intergenic
1106513978 13:30436805-30436827 AAGAAAGAGGAAAAGGAGGCTGG - Intergenic
1106514640 13:30442875-30442897 GAAATTGAGGCACAGGAGGCTGG + Intergenic
1107615871 13:42167529-42167551 AAGATAAAGGCAATGGAAGCAGG - Intronic
1108863987 13:54899465-54899487 AAGATAGAGGCATAGGAGGCTGG + Intergenic
1109148914 13:58819207-58819229 TAAATTAAGGCAAATGAGGATGG - Intergenic
1110490332 13:76096051-76096073 AAGAAAAAGGGAAGGGAGGCAGG - Intergenic
1110602809 13:77395485-77395507 AAGATTAAGGCAAGGGATGGTGG + Intergenic
1110647202 13:77901970-77901992 GACATTAATGCAAAGGGGGCTGG - Intronic
1110820806 13:79913883-79913905 AAGATGAAGGCAAAGGGGATAGG - Intergenic
1115823156 14:37234476-37234498 AAAATTAAGGCAAAGCATGGTGG - Intronic
1116692090 14:48121167-48121189 AAAACTAAGGAAGAGGAGGCAGG - Intergenic
1117419594 14:55531046-55531068 AAGATTGAGACAGAGGAGGAAGG + Intergenic
1117419826 14:55533180-55533202 AGGATTAGAGAAAAGGAGGCAGG + Intergenic
1118365402 14:65091031-65091053 ATGCTTAAGTCAAAGGAGACTGG + Intronic
1118382097 14:65225808-65225830 AAGGTGAAGACAAAGGAGACTGG + Intergenic
1118718365 14:68576218-68576240 AAGCTAGAGGCAAAGGAAGCTGG + Intronic
1119190989 14:72681589-72681611 AAGATGGAGGAAAAGAAGGCAGG - Intronic
1119591665 14:75894253-75894275 AAGTTAGAAGCAAAGGAGGCTGG + Intronic
1120367761 14:83592148-83592170 AAAAATAAGGCAAAGCAGCCGGG + Intergenic
1121476400 14:94210749-94210771 AAGAATAAGGCAAATGAGAAGGG + Intronic
1121908657 14:97769565-97769587 AAGCTGGAGGCCAAGGAGGCTGG + Intergenic
1124367948 15:29087409-29087431 AAGATTAAGTCACTGGATGCTGG - Intronic
1126008137 15:44278295-44278317 AAAAATAAGGCTATGGAGGCTGG + Intergenic
1126358830 15:47824289-47824311 AAGATTATAGGAGAGGAGGCAGG - Intergenic
1126748548 15:51851992-51852014 AAACTTAAAGCAAAGGAGGTGGG - Intronic
1126964797 15:54039845-54039867 ATGATGAAGGCAAAGGATGGGGG - Intronic
1128015320 15:64339702-64339724 AAGATTAAAGCAAAAGAAACAGG + Intronic
1129377119 15:75140666-75140688 AAGATCAGGGGAAAGGAGGGGGG + Intergenic
1130033091 15:80333488-80333510 AAGCTGGAGGCCAAGGAGGCTGG - Intergenic
1130558837 15:84943356-84943378 AAAATTAAGGCCAGGGAGCCTGG + Intronic
1131061085 15:89405093-89405115 AGGATTAGGGGAAAGGGGGCAGG + Intergenic
1133314018 16:4870903-4870925 AAGATGAAGAAAAAGGGGGCAGG + Exonic
1133639150 16:7700068-7700090 AAGATTAAGACAAAACAAGCAGG - Intronic
1135147421 16:19974743-19974765 CAGATTAAGGCAGATGAGGGAGG + Intergenic
1138440245 16:57029968-57029990 AAGATTGTGGCAAAGGTGTCAGG - Intronic
1139295686 16:65898446-65898468 AGGAGTGGGGCAAAGGAGGCAGG + Intergenic
1139449578 16:67018736-67018758 AAGAAAAAAGAAAAGGAGGCAGG + Intergenic
1139491151 16:67286700-67286722 AAGAAGAAGGCAGAAGAGGCTGG + Intronic
1142886911 17:2918557-2918579 AAGGTGAAGGGAGAGGAGGCAGG + Intronic
1142988751 17:3714773-3714795 AAAAGTAATGCAAAGGATGCTGG + Exonic
1144722757 17:17483640-17483662 AAGAATGAGGAAAGGGAGGCTGG + Intronic
1145848443 17:28065978-28066000 AAGATAAAGCCAAGGGATGCAGG + Intronic
1146264666 17:31444449-31444471 CTGATTAAGCCAAAGGTGGCGGG + Intronic
1146910742 17:36646859-36646881 AAGAATAGGAGAAAGGAGGCAGG + Intergenic
1147202835 17:38814972-38814994 AAGATGGAGGAGAAGGAGGCAGG - Exonic
1147511114 17:41069555-41069577 CAGGTTGAGGCAAAGGAGGGGGG + Intergenic
1147549635 17:41430595-41430617 AAGAATAAAGCAAACTAGGCAGG - Intergenic
1147926695 17:43951037-43951059 AAGGATGAGGCAGAGGAGGCAGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1150250658 17:63702534-63702556 GAGATTGAGGCAGAGGATGCTGG - Intergenic
1150700919 17:67446239-67446261 AAGAATCAGTCAAAGAAGGCTGG - Intronic
1151498326 17:74473117-74473139 AAGGGTAAGGGAAAGGAGGCAGG + Intronic
1151685682 17:75645144-75645166 AACTTAAAGGCAAAGGAAGCTGG + Intronic
1152002478 17:77655319-77655341 AAGGTTGAGGCTGAGGAGGCTGG + Intergenic
1152542555 17:80983656-80983678 AAGATGAAGGCAGAGGACGGGGG + Intergenic
1152594180 17:81230271-81230293 AACATTAAGGCAGCGGAGTCTGG + Intronic
1153855736 18:9144276-9144298 AAGATTATGCAAAAGGAGGTTGG - Intronic
1155439353 18:25845111-25845133 CAATTTAATGCAAAGGAGGCTGG - Intergenic
1155482058 18:26299560-26299582 AAGCTTAAAACAAAGGAGGGGGG - Intronic
1156029270 18:32693266-32693288 TAGATCTGGGCAAAGGAGGCTGG - Intronic
1156674245 18:39508360-39508382 AAGATGAAGGCAGAGCAGGAGGG + Intergenic
1157140529 18:45101510-45101532 GAGATTAAGGTAAATGAGGCTGG - Intergenic
1157632913 18:49117804-49117826 AAGACGAAGACAAAGGAGCCAGG - Intronic
1159858260 18:73615182-73615204 AAGATTAATTCCATGGAGGCTGG - Intergenic
1160934708 19:1588483-1588505 AAGATGAAGGGAAACAAGGCCGG + Intronic
1161927593 19:7312817-7312839 AAGAATTAGGGAAAGAAGGCTGG - Intergenic
1161957598 19:7505277-7505299 AAGAATAAGGTAAAGTGGGCTGG - Intronic
1162998323 19:14350459-14350481 AGTATGAAGGCAAAGGGGGCAGG - Intergenic
1163462884 19:17449213-17449235 AAAATAAAGAGAAAGGAGGCCGG + Intronic
1164811721 19:31162769-31162791 AAGATTAACCCAAAGTAGGGAGG + Intergenic
1164838879 19:31377470-31377492 AAGGCTTAGGCAAAGGAGGGTGG - Intergenic
1165301309 19:34971208-34971230 AAGAATATGGCAAAGGTGGTGGG - Intergenic
1166642582 19:44506516-44506538 TAGAATATGGCAAAGGTGGCAGG + Intronic
1166881289 19:45931666-45931688 GAGACCAAGGCCAAGGAGGCTGG - Intergenic
1167863049 19:52300446-52300468 AAGAGGAAAGCAAAGGAGTCAGG + Exonic
1167868642 19:52349197-52349219 AAGAGGAAAGCAAAGGAGTCAGG + Exonic
1167887908 19:52517042-52517064 AAGAGGAAAGCAAAGGAGTCAGG + Intergenic
1167895093 19:52574124-52574146 AAGAGGAAAGCAAAGGAGTCAGG + Exonic
1167910637 19:52699167-52699189 AAGAGGAAAGCAAAGGAGTCAGG - Intergenic
1167918293 19:52760393-52760415 AAGAGGAAAGCAAAGGAGTCAGG - Intergenic
1167925471 19:52817960-52817982 AAGAGGAAAGCAAAGGAGTCAGG - Exonic
1167929715 19:52854274-52854296 AAGAGGAAAGCAAAGGAGTCAGG - Exonic
1167933785 19:52890257-52890279 AAGAGGAAAGCAAAGGAGTCGGG - Exonic
1167937062 19:52917875-52917897 AAGAGGAAAGCAAAGGAGTCAGG - Intergenic
1167969923 19:53182900-53182922 AAGAGGAAGGCAAAGGAGTCAGG - Exonic
1167988929 19:53341284-53341306 AAGAGGAAAGCAAAGGAGTCAGG + Exonic
1167995428 19:53397992-53398014 AAGAGGAAAGCAAAGGAGTCAGG + Exonic
1168005562 19:53483799-53483821 AAGAGGAAAGCAAAGGAGTCAGG + Exonic
1202697439 1_KI270712v1_random:135299-135321 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
925705732 2:6683341-6683363 AAATTTAAGGCAAAGGGGTCTGG + Intergenic
926770436 2:16368319-16368341 AAGAATAAGTCAAGGGAGGGGGG + Intergenic
926935352 2:18082022-18082044 AAGAATAAGGCAAACAAGCCTGG - Intronic
927345443 2:22033411-22033433 AAGACTAAGGCACAGCATGCGGG + Intergenic
928700793 2:33896577-33896599 AAGATGAAGGCTAAAAAGGCTGG + Intergenic
929034717 2:37679741-37679763 AAGAGGAAGGCACAGGAGGCTGG - Intronic
930989717 2:57638315-57638337 AAGATGAAGGAAAAGGAGGTAGG + Intergenic
931258738 2:60598379-60598401 AAGATTAAGGCAGAGTAGACAGG - Intergenic
932109809 2:68987773-68987795 CAAATTAAGGCACAAGAGGCCGG + Intergenic
932179990 2:69638337-69638359 AAGCTTAAGCAAAAGCAGGCAGG - Intronic
933522198 2:83388307-83388329 AAGATTATAAGAAAGGAGGCAGG - Intergenic
934278608 2:91592324-91592346 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
935653573 2:105402625-105402647 AATAGTAAGTCAAAGGAGGATGG + Intronic
937099230 2:119255917-119255939 ATGATAAAGGAAACGGAGGCAGG + Intronic
938238514 2:129724848-129724870 AGGACTATGGCCAAGGAGGCAGG + Intergenic
938779059 2:134568226-134568248 AAGAATAAAGGAAAGAAGGCAGG + Intronic
939903388 2:147879268-147879290 AAGATCAAGGCAAAGGCATCTGG + Intronic
941405635 2:165084135-165084157 AACATTAAGTTAGAGGAGGCTGG - Intergenic
941417455 2:165239452-165239474 AAAGCTAAGGCAAAGGAGGGAGG + Exonic
942295893 2:174516883-174516905 AAGAGAAAGGTAAAGAAGGCAGG - Intergenic
943487819 2:188509344-188509366 AAGGTCAAAGCAAAGAAGGCTGG - Intronic
944527592 2:200635777-200635799 GAGAGTAAGGGAAATGAGGCAGG + Intronic
944605654 2:201349405-201349427 AAGATGCAGGCAAAGCAGGTAGG - Intronic
944727491 2:202485838-202485860 AAGATAAAGGCAAAGGGGCTGGG - Intronic
946730717 2:222706896-222706918 AAAATTAAGGCCAGAGAGGCTGG + Intronic
947518061 2:230824114-230824136 AATATTGAGGCAAAAGAGACAGG - Intergenic
948568443 2:238901270-238901292 GAGCAAAAGGCAAAGGAGGCCGG - Intronic
1168817030 20:745008-745030 AAGAATAAGGGAAGGTAGGCTGG + Intergenic
1170164143 20:13344704-13344726 ATGAGGAAGGCAAAGGATGCCGG - Intergenic
1172726965 20:37051930-37051952 AACATTAATGAAAAGAAGGCAGG + Intronic
1173150280 20:40561456-40561478 CAGTCTCAGGCAAAGGAGGCTGG - Intergenic
1173343755 20:42179055-42179077 AAGAATGTGGCATAGGAGGCAGG + Intronic
1173599632 20:44284377-44284399 CCAATTAAGGCAAATGAGGCTGG + Intergenic
1173622991 20:44450705-44450727 AAAATTAAGGCAAAACAGGGAGG - Intergenic
1173960103 20:47064251-47064273 AACATTATGCCAAATGAGGCTGG - Intronic
1174111324 20:48200040-48200062 CAGATTGAGGCAAAGGGGTCAGG + Intergenic
1174568740 20:51485965-51485987 AAGATCCAGGCCAAGGAGGGTGG + Intronic
1174602523 20:51736226-51736248 AAGATAAAGGACAAGGAGGGAGG + Intronic
1174667682 20:52275134-52275156 GAGAGTATGACAAAGGAGGCAGG - Intergenic
1175377587 20:58539868-58539890 AAGATTATGGCAAAGGCTACAGG - Intergenic
1175735704 20:61385633-61385655 AAGATAACGGGAGAGGAGGCAGG - Intronic
1178198002 21:30370333-30370355 AAGCTTAAGGGAAAGGTGTCAGG + Intronic
1178996485 21:37405341-37405363 AAGAATTAGGAAAAGGATGCAGG - Intronic
1179228035 21:39473586-39473608 AAGAGTAACACACAGGAGGCTGG + Intronic
1184954913 22:47879530-47879552 AAAAATAAGGCCAAGGGGGCAGG - Intergenic
1185304942 22:50109852-50109874 AAGAGAAAGGAAAAGGAGGCTGG + Intronic
949376124 3:3392304-3392326 AAGAAAAAGGCAAAGGAAGATGG + Intergenic
949870916 3:8587775-8587797 TAGATTAAGGCCAAGGAGAGAGG - Intergenic
950077701 3:10199006-10199028 AAGATTCAGGCTAAGGAGTGTGG + Intronic
950080195 3:10216460-10216482 AAGAGGAAGGCAAAGGAGGAGGG + Intronic
950210470 3:11119336-11119358 AAGAATGGAGCAAAGGAGGCCGG - Intergenic
952165175 3:30740117-30740139 AAGAAGAAAGCAAAGCAGGCAGG + Intronic
952635343 3:35522632-35522654 GAGAATGAGGCAGAGGAGGCAGG - Intergenic
954167857 3:48775140-48775162 AAGATTAAAACAAAGCAGGTCGG + Intronic
954207618 3:49071991-49072013 AAGGTTAAGTAAAAGAAGGCTGG - Intronic
954245531 3:49328561-49328583 AAGATTAAAGCAATTCAGGCCGG + Intronic
956581272 3:70816648-70816670 AAGAGTAAGGCAATATAGGCTGG + Intergenic
956642244 3:71426199-71426221 AAGAATCAGGCAAAGGAGTCAGG + Intronic
956729820 3:72186413-72186435 AAGAGTGAGGCAGAAGAGGCTGG + Intergenic
958484534 3:94687187-94687209 AAGAATAAGGCTAGGGAGGGAGG - Intergenic
958637869 3:96767838-96767860 AATAATAACACAAAGGAGGCAGG + Intergenic
958870623 3:99554642-99554664 AAAATTAAGAAAAAAGAGGCAGG + Intergenic
960292993 3:115909160-115909182 AAGATCAAAGCTAAGGATGCAGG - Intronic
963559906 3:146851307-146851329 AAGATGAAGGAAAAGGAGAAAGG + Intergenic
964236002 3:154528592-154528614 AAGAAAAAGGAAAAGGAGGAAGG - Intergenic
964272195 3:154968523-154968545 AAGATTGAGGCTAAGTAGGTGGG + Intergenic
964526933 3:157625035-157625057 AAGAGAAAGGCAAAGGAGATTGG + Intronic
965583319 3:170292596-170292618 AAGTTTAAGACCAAGGAGGCAGG + Intronic
965876830 3:173333953-173333975 AAGATTATTGCAGAGGAAGCAGG - Intergenic
966199280 3:177344727-177344749 AAGATTAAGGCCAAGGAAACTGG - Intergenic
966260221 3:177968527-177968549 AAGACTAATGAAAAGAAGGCTGG + Intergenic
966596170 3:181726286-181726308 AAGATTGAGGGCGAGGAGGCTGG - Intergenic
967548917 3:190766544-190766566 AAGATTAAGGTAAAGATGGTTGG - Intergenic
968012899 3:195298555-195298577 ATGATTAAGGAAAAGGAGAGAGG - Intronic
969499927 4:7546430-7546452 AATATTGAGGCAAAGATGGCAGG - Intronic
970068503 4:12127466-12127488 AAGATTAAGGCAAATGTGCCAGG + Intergenic
972663566 4:41142084-41142106 AAGATGGAGGAAAAGGATGCTGG + Intronic
974640127 4:64619030-64619052 AATATTAAGGAAAAGGAGTAAGG - Intergenic
975349323 4:73328334-73328356 AGGATTAAGCCAAAGGACCCTGG + Intergenic
976260863 4:83143641-83143663 AAAATGTAGGCATAGGAGGCCGG - Intergenic
976386908 4:84470539-84470561 AATCTAAAGGCAAAGGAGGCTGG + Intergenic
976718692 4:88150007-88150029 AAAATTAAAGCAAAAGAGGAAGG + Intronic
976993947 4:91405841-91405863 GAGATTAAGCCAAAGCAGGGTGG - Intronic
977330547 4:95631993-95632015 GAGATTAAGGGAATGGAGGTGGG - Intergenic
978396207 4:108282784-108282806 AAGATTCAGGCAAAGGTGGGTGG + Intergenic
978488539 4:109284688-109284710 CACATGAAGGCAAAGGAAGCTGG + Intronic
978593973 4:110356674-110356696 AAGTGTTTGGCAAAGGAGGCTGG - Intergenic
979792594 4:124804416-124804438 CAGAGTAAGGCAAAGAAGGTGGG - Intergenic
980192202 4:129539277-129539299 AAAATTAAGGCAGAGCAGGTAGG + Intergenic
980933340 4:139202690-139202712 AAGATGTAGTGAAAGGAGGCCGG + Intergenic
981087394 4:140698274-140698296 AGGATTAAGGAAGAGGAAGCTGG - Intronic
981995899 4:150975231-150975253 AAGATAAAGGTAAAGTAGCCAGG + Intronic
982322125 4:154088121-154088143 ATCATGAATGCAAAGGAGGCCGG - Intergenic
983111242 4:163752434-163752456 AAAATTAAAGCCAAGTAGGCTGG - Intronic
983136846 4:164094495-164094517 AACCTTATGGCAATGGAGGCAGG - Intronic
983701573 4:170602135-170602157 AAAATAAATGCAAAGGAGCCTGG + Intergenic
983977259 4:173950559-173950581 AAGAATATGGGAAATGAGGCCGG - Intergenic
985047645 4:185956455-185956477 AAGGTTAAGGCAGAGGAGTTCGG - Exonic
985277339 4:188250698-188250720 AAGAGAAAAGCAAAGGATGCAGG + Intergenic
985402537 4:189606714-189606736 AAGATGGAGGGAAAGGAAGCTGG - Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
988361051 5:30237058-30237080 AAGATTAAAGGAAAATAGGCAGG + Intergenic
988444587 5:31271398-31271420 AAGGTTAAGACAGAGGAGGAAGG - Intronic
988602210 5:32650246-32650268 GTGAATAAGGCAAAGTAGGCAGG - Intergenic
988857499 5:35243197-35243219 AAAAAGAAGGCAAAGTAGGCTGG + Intergenic
988886699 5:35565492-35565514 AAAATTAAAGCAAAGGAGATAGG - Intergenic
989236130 5:39150450-39150472 AAGATTGAAGCAGAGGAGGTTGG - Intronic
991983428 5:72257786-72257808 AAGATTAAAGAATTGGAGGCTGG + Intronic
992297920 5:75344897-75344919 AACATTAAGGACATGGAGGCCGG - Intronic
992681215 5:79155045-79155067 AAGATTAAGCCAAAAGAGAGAGG + Intronic
992954522 5:81893521-81893543 AAAAGGAAGGGAAAGGAGGCTGG + Intergenic
993439587 5:87939361-87939383 AAAATCAAGGAAAGGGAGGCAGG - Intergenic
993565118 5:89464775-89464797 AAGACTAACGCAAAGAAGGAAGG - Intergenic
996447991 5:123580150-123580172 AAGATCCAGGCAAAGCAGGGAGG - Intronic
996956256 5:129186799-129186821 AAGATTAATGCTAATGAGGGAGG + Intergenic
997045545 5:130312524-130312546 AAGATTAGGGAACTGGAGGCTGG - Intergenic
998215837 5:140238155-140238177 AAGCTGCAGGAAAAGGAGGCAGG + Intronic
998269855 5:140696783-140696805 AAGCTAGAGGCAAAGGAGGAGGG + Intronic
998273191 5:140725866-140725888 AAGCTGGAGGCAAAGGAGGTGGG + Intergenic
1000186353 5:158862252-158862274 CAGATTCAGCCAAAGTAGGCTGG + Intronic
1000944049 5:167398746-167398768 AGGAATAAGGGAAAGGGGGCTGG - Intronic
1001282837 5:170400145-170400167 AAGAATATGGCATAGGAGTCAGG - Intronic
1001330210 5:170756672-170756694 AAGGGTAAGGAAAAGGAGGTTGG + Intergenic
1001388343 5:171358380-171358402 AGGATTAGTGCAATGGAGGCAGG - Intergenic
1003844741 6:10161304-10161326 TAGATAAAGGTAAAGAAGGCAGG + Intronic
1004251889 6:14029596-14029618 AAAAATAAGGAAAATGAGGCTGG + Intergenic
1004580454 6:16946287-16946309 AAAATTAAGCCAAAGCAGGCAGG - Intergenic
1004709781 6:18158278-18158300 AAGATTAAGTCAAAGGAGGCCGG + Intronic
1004894582 6:20135529-20135551 AAGATTAAGGTAAAATAGGTAGG - Intronic
1005478785 6:26234851-26234873 AAGAAAAAGGCGAAGAAGGCAGG - Exonic
1007573644 6:42911016-42911038 AAAATTAAGAAAAAGTAGGCCGG - Intergenic
1007731994 6:43953026-43953048 AAGATAAAGGGAAAGGGGACAGG - Intergenic
1007983163 6:46179891-46179913 AAGAGTGAGGACAAGGAGGCAGG + Intergenic
1008603067 6:53114486-53114508 AAGAGTAAGTCAATGGAGGAAGG + Intergenic
1009929275 6:70157008-70157030 AAAAGTAAGGGAAAGGAGGAAGG + Intronic
1010295037 6:74185640-74185662 AAGTAGAAGGAAAAGGAGGCAGG + Intergenic
1010954434 6:82074008-82074030 AAGATTAAAGAAATAGAGGCTGG + Intergenic
1011253659 6:85399644-85399666 GAGATCAAGGCAAAGAAGGGAGG + Intergenic
1011352380 6:86436332-86436354 AAGATACAGGGAAAGGAGGTAGG + Intergenic
1012893721 6:104925610-104925632 AAGATTAAGTCATGGGAGGTTGG - Intergenic
1013390798 6:109684576-109684598 AAAAAGTAGGCAAAGGAGGCCGG + Intronic
1014904706 6:127012023-127012045 AAGAAAAAGGGAAATGAGGCAGG - Intergenic
1015237603 6:130988790-130988812 AAGAATGAAGGAAAGGAGGCTGG + Intronic
1015277434 6:131398863-131398885 AAGATTTAGGGGCAGGAGGCCGG + Intergenic
1017674021 6:156795329-156795351 GAGAATAAGGGAAGGGAGGCCGG + Intronic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1019046139 6:169147717-169147739 AAGACTGAGGCAAAGGAGGGTGG + Intergenic
1019133033 6:169891154-169891176 AAGATGAAGGACAAGGAGGGTGG + Intergenic
1019636437 7:2078553-2078575 AAGAAGAAAGCAGAGGAGGCTGG + Intronic
1020412836 7:7912178-7912200 TATTTTAAGTCAAAGGAGGCTGG - Intronic
1021464913 7:20931485-20931507 AAGATGAAAGAAAGGGAGGCAGG - Intergenic
1023475827 7:40576810-40576832 AAGGTGAAAGCATAGGAGGCAGG - Intronic
1023741946 7:43288893-43288915 AAGAATAAGGCAAGAGAGGTAGG - Intronic
1024919304 7:54541706-54541728 AAGATGAAGGAAAAGAAGGCAGG + Intergenic
1025227832 7:57179673-57179695 AAGACCAAGGCAGAGGAGGTGGG - Intergenic
1027025493 7:74848840-74848862 AAAATAAAGGCAAAGGTGACAGG + Intronic
1027062271 7:75095279-75095301 AAAATAAAGGCAAAGGTGACAGG - Intronic
1027134151 7:75612212-75612234 AAAACAAAGGCAGAGGAGGCCGG + Intronic
1028877425 7:95839325-95839347 AAGAAAAAGAGAAAGGAGGCTGG - Intronic
1029065430 7:97843559-97843581 AAGACAAAGGAAAAGCAGGCAGG + Intergenic
1029267236 7:99352048-99352070 AAGAGAAAGCCAAGGGAGGCTGG - Intronic
1029787898 7:102810879-102810901 AAAATTAATGAAAAGGAGGCTGG - Intergenic
1030007967 7:105137125-105137147 AAGTTTGAGGCAAAGGACACGGG + Intronic
1030198562 7:106877842-106877864 AAAAATAATGCAAAGGATGCGGG - Intronic
1030383149 7:108836189-108836211 AAGAACAAAGCAAAAGAGGCCGG - Intergenic
1030740707 7:113106101-113106123 AAGAATAATGCAAAGCAGGAAGG + Intergenic
1031539743 7:122978955-122978977 AAGATTAAGGCATTGGAGCGAGG - Intergenic
1031693122 7:124815668-124815690 AACATTAAAGCAAGGGTGGCTGG + Intergenic
1031733475 7:125327231-125327253 AAGATTATGGCAAGGCAGCCTGG - Intergenic
1032310388 7:130780621-130780643 GGGCTGAAGGCAAAGGAGGCTGG - Intergenic
1032662326 7:133998594-133998616 AAGAATAAGGCACAGGAGACAGG + Intronic
1033023228 7:137748188-137748210 GAAACTAAGGCAAAGGAGGAAGG + Intronic
1034134112 7:148749772-148749794 ATGATTAAGCCAAATGAGGAAGG + Intronic
1035111056 7:156482189-156482211 AAGATTAAAGAAGAGTAGGCTGG + Intergenic
1037505439 8:19524876-19524898 AAGAATCAGGCAAAAGATGCTGG + Intronic
1038424328 8:27454578-27454600 AAGATGACGGCAAGGAAGGCAGG - Exonic
1040365274 8:46709008-46709030 AAGACAAAGGAAAAGCAGGCAGG - Intergenic
1041741252 8:61159309-61159331 AAGTTTAAGGCAGATGAGGTAGG - Intronic
1042199267 8:66264701-66264723 AAGATTAAGACAAGGGAGCTGGG + Intergenic
1043788727 8:84435730-84435752 AAGATTCAGGAAAGAGAGGCTGG - Intronic
1044154625 8:88828275-88828297 AAAATTAAGGCAGAGAAGACTGG - Intergenic
1044307162 8:90651020-90651042 TAGATTGAGGTAAAGAAGGCTGG + Intronic
1044688030 8:94846568-94846590 AAGAATAAGTAAAAAGAGGCTGG - Intronic
1044805141 8:95999722-95999744 AAGCTTAATCTAAAGGAGGCAGG + Intergenic
1045834863 8:106507965-106507987 AAGAAGAAGCCAGAGGAGGCTGG - Intronic
1046454016 8:114435663-114435685 AAGATTAAGGCAAGGGAAATTGG + Intergenic
1047112938 8:121811116-121811138 AAGATGAAGGAAGAGGAGGAGGG + Intergenic
1047174797 8:122530130-122530152 AAGAGTATGGCAAAGGAAACAGG + Intergenic
1047728867 8:127709199-127709221 AAGAATGAGGCCAAGGAGGCCGG - Intergenic
1048927637 8:139284794-139284816 AAGAATAAAACAAAGCAGGCTGG - Intergenic
1051130780 9:13857795-13857817 AAGATTCAGTCACATGAGGCAGG + Intergenic
1051792798 9:20826945-20826967 AAAATTAAGGCAAATGATGGTGG - Intronic
1052672626 9:31577526-31577548 AAGATGAAGGCAAGAAAGGCAGG + Intergenic
1053262926 9:36686270-36686292 ATGAGTTAGGCAAATGAGGCCGG + Intergenic
1054355773 9:64061094-64061116 AAGCTAAAGGCACAGGAGGCAGG - Intergenic
1055802810 9:80059099-80059121 AAGATATAGGCAGAGGAGCCTGG + Intergenic
1056412659 9:86346908-86346930 AAGATGAAAGCAAATGTGGCTGG - Intronic
1056617231 9:88179014-88179036 AAGGTTAAGGGAAAGGAGGGAGG + Intergenic
1057132787 9:92666344-92666366 AAGCTGAAGGCGAAGGAGGCAGG + Intronic
1057185345 9:93054482-93054504 AAGAATAAAGCAAAACAGGCTGG + Intergenic
1057980397 9:99655596-99655618 AATAATAGGGCAAAGGAGGGAGG + Intergenic
1059063992 9:111063471-111063493 AGGAGTAAGGGAAAGAAGGCTGG + Intergenic
1059141453 9:111856830-111856852 AAAATAAAGGCAAAGTTGGCCGG - Intergenic
1059475106 9:114540306-114540328 CAGAATTATGCAAAGGAGGCCGG + Intergenic
1059588319 9:115630103-115630125 AAGCCTAAGGAAAAGGAGGGAGG + Intergenic
1059710172 9:116860587-116860609 AAGAATCATGGAAAGGAGGCTGG - Intronic
1059756982 9:117302970-117302992 AAGATTAAGGCATTTCAGGCAGG - Intronic
1061218378 9:129235086-129235108 CAGATTGGGGGAAAGGAGGCCGG - Intergenic
1061481798 9:130901163-130901185 AAGTTTAGGGGAAAGGAGGAAGG + Intergenic
1062360879 9:136187497-136187519 AAGATTCTGGCAAAGCACGCAGG + Intergenic
1185611093 X:1394136-1394158 AAGAAAAAAGAAAAGGAGGCGGG - Intergenic
1185611105 X:1394206-1394228 AAGAAAAAGGAAAAGGAGGGAGG - Intergenic
1185853788 X:3513361-3513383 GAGAATGAGGCAAAGGAGTCTGG + Intergenic
1186676459 X:11822445-11822467 AAGAGGAAGTCTAAGGAGGCTGG + Intergenic
1190156807 X:48000264-48000286 AAAATTAATGCAAAAGAGCCGGG + Intronic
1194996418 X:100596025-100596047 AAGATTAAGGCAAAGGAGGCGGG + Intronic
1195096639 X:101507599-101507621 AAGATTAAGCCATAGGATGTAGG - Intronic
1195512691 X:105735667-105735689 AAGAATAAGGCAAAGCAGGGTGG - Intronic
1196096968 X:111810206-111810228 TAGAATATGGCAAAAGAGGCAGG - Intronic
1197257861 X:124283384-124283406 AAAAAAAGGGCAAAGGAGGCCGG - Intronic
1197806911 X:130406149-130406171 GAAATAAAGGCAAAGCAGGCCGG - Intronic
1198444826 X:136702001-136702023 AAGAATAAGAAAAATGAGGCCGG - Intronic
1198658800 X:138943910-138943932 AAAAGGAAAGCAAAGGAGGCTGG + Intronic
1199009561 X:142743124-142743146 TAGATTAAAGACAAGGAGGCTGG - Intergenic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic