ID: 1194997754

View in Genome Browser
Species Human (GRCh38)
Location X:100610444-100610466
Sequence CGACCACCTGTCTCATCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194997754_1194997756 -9 Left 1194997754 X:100610444-100610466 CCACAGGATGAGACAGGTGGTCG No data
Right 1194997756 X:100610458-100610480 AGGTGGTCGGCACAAGATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194997754 Original CRISPR CGACCACCTGTCTCATCCTG TGG (reversed) Intergenic
No off target data available for this crispr