ID: 1195004886

View in Genome Browser
Species Human (GRCh38)
Location X:100676162-100676184
Sequence CTCCTCAGGGATCAGTAATG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 133}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195004886_1195004897 25 Left 1195004886 X:100676162-100676184 CCCCATTACTGATCCCTGAGGAG 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1195004897 X:100676210-100676232 GCCCCACTCTCAGCCCACCAGGG 0: 1
1: 0
2: 4
3: 35
4: 337
1195004886_1195004893 2 Left 1195004886 X:100676162-100676184 CCCCATTACTGATCCCTGAGGAG 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1195004893 X:100676187-100676209 ACACCAGAAGAGGCTAAAGAGGG 0: 1
1: 0
2: 2
3: 18
4: 223
1195004886_1195004896 24 Left 1195004886 X:100676162-100676184 CCCCATTACTGATCCCTGAGGAG 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1195004896 X:100676209-100676231 GGCCCCACTCTCAGCCCACCAGG 0: 1
1: 0
2: 1
3: 35
4: 355
1195004886_1195004894 3 Left 1195004886 X:100676162-100676184 CCCCATTACTGATCCCTGAGGAG 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1195004894 X:100676188-100676210 CACCAGAAGAGGCTAAAGAGGGG 0: 1
1: 0
2: 3
3: 27
4: 207
1195004886_1195004892 1 Left 1195004886 X:100676162-100676184 CCCCATTACTGATCCCTGAGGAG 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1195004892 X:100676186-100676208 AACACCAGAAGAGGCTAAAGAGG 0: 1
1: 0
2: 3
3: 24
4: 259
1195004886_1195004891 -8 Left 1195004886 X:100676162-100676184 CCCCATTACTGATCCCTGAGGAG 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1195004891 X:100676177-100676199 CTGAGGAGAAACACCAGAAGAGG 0: 1
1: 0
2: 3
3: 17
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195004886 Original CRISPR CTCCTCAGGGATCAGTAATG GGG (reversed) Exonic
900267055 1:1762926-1762948 CTCCTCAGGGTCCAGCACTGAGG + Intronic
903161447 1:21491897-21491919 CTCCCCAGGGTTCAGAAATTTGG + Intergenic
904787200 1:32991965-32991987 CGCCTCAGTCATCAGTGATGGGG - Intergenic
908512620 1:64861445-64861467 CTCTTCAGGGATCAATGATCAGG - Intronic
910514518 1:88045156-88045178 CTCCTCAGGAAGTAGGAATGAGG + Intergenic
915854466 1:159367001-159367023 CACCACAGGGTTCAGTAACGGGG - Intergenic
922135791 1:222825131-222825153 CTCCCCAGGGATGGGGAATGTGG + Intergenic
1062924111 10:1301602-1301624 CTCTTCAGGGTTCATTAATTTGG + Intronic
1068521724 10:58084516-58084538 CTCTTCAGGGGTCAGTTAGGTGG - Intergenic
1068726500 10:60308813-60308835 CTCCTGGGGGCTCAGTAAAGTGG - Intronic
1071401775 10:85280199-85280221 CTACTCAAGCCTCAGTAATGTGG + Intergenic
1071528678 10:86373119-86373141 CTCCCAAGGGATCAGGGATGGGG + Intergenic
1072274198 10:93806639-93806661 CTCCTCAGGGATCAGAATCTGGG - Intergenic
1073751549 10:106533838-106533860 CTCAACAAGGAGCAGTAATGAGG - Intergenic
1076693805 10:132237404-132237426 CTCCTCCTGAATCAGTCATGAGG + Intronic
1080596777 11:33780092-33780114 GTGCCCAGGGATTAGTAATGGGG - Intergenic
1083259355 11:61514855-61514877 CACCTCAGGGACCAGGAAGGAGG + Intergenic
1088449753 11:109968597-109968619 ATGCCCAGGGAGCAGTAATGGGG + Intergenic
1088830479 11:113532268-113532290 CTCCTCTGGGCTCAGGAAAGTGG + Intergenic
1090496387 11:127216910-127216932 CTCATCAGGGAGCAGGAAGGAGG - Intergenic
1101763312 12:107676915-107676937 CTCCTCTGGCATCACAAATGGGG + Intergenic
1104765581 12:131328080-131328102 CTCCCCAGGGAGCTGTAATTAGG - Intergenic
1104813742 12:131633972-131633994 CTCCCCAGGGAGCTGTAATTAGG + Intergenic
1107046785 13:36001246-36001268 CTCCTAAAGAATCAGTTATGCGG - Intronic
1107324562 13:39227151-39227173 GTCCTCAGGGCTCAGTATAGTGG + Intergenic
1107957280 13:45527760-45527782 CACCTCAGGGATCACTAAATCGG - Intronic
1109367447 13:61373988-61374010 ATTCTCAGTGATCAGTACTGTGG - Intergenic
1109661623 13:65467415-65467437 CTTCTCAAGCCTCAGTAATGGGG + Intergenic
1112901063 13:104357311-104357333 CTTCTCAGGGCTCAGTATTTTGG - Intergenic
1119080127 14:71685060-71685082 CTCCTCAGGTCTCAGTAGTCTGG + Intronic
1123011594 14:105352496-105352518 CTCCCCAGGGGACAGTGATGAGG - Intronic
1123011607 14:105352528-105352550 CTCCCCAGGGGACAGTGATGAGG - Intronic
1123011692 14:105352749-105352771 CTCCCCAGGGTACAGTGATGGGG - Intronic
1123011703 14:105352781-105352803 CTCCCCAGGGAACAGTGATGGGG - Intronic
1123011716 14:105352812-105352834 CTCCCCAGGGGACAGTGATGGGG - Intronic
1123011753 14:105352906-105352928 CTCCCCAGGGGACAGTGATGAGG - Intronic
1123011789 14:105353001-105353023 CTCCCCAGGGGACAGTGATGAGG - Intronic
1123011799 14:105353032-105353054 CTCCCCAGGGGACAGTGATGGGG - Intronic
1123011839 14:105353128-105353150 CTCCCCAGGGGACAGTGATGAGG - Intronic
1123011877 14:105353224-105353246 CTCCCCAGGGGACAGTGATGAGG - Intronic
1123871725 15:24581683-24581705 GACCACTGGGATCAGTAATGAGG + Intergenic
1124343329 15:28903876-28903898 CTCCTCAGGGACAAGTGAGGAGG - Intronic
1125932849 15:43612473-43612495 CTCCTCAGGGCTCAGGAAACAGG + Exonic
1125945948 15:43711935-43711957 CTCCTCAGGGCTCAGGAAACAGG + Intergenic
1127056295 15:55135534-55135556 CTACTCAAGCCTCAGTAATGGGG - Intergenic
1128611413 15:69076593-69076615 CTGCTCAGGAATCAGGAATCAGG - Intergenic
1133268955 16:4601356-4601378 CTCCTCATGGATCAGCCAAGAGG - Intergenic
1134053905 16:11157238-11157260 CTAGTCAGTGATCAGTGATGTGG + Intronic
1134682211 16:16134245-16134267 CACCTCAGGCATCAGTCATCTGG - Intronic
1136682254 16:31975264-31975286 TTCATCAGGGATCAGTGGTGTGG - Intergenic
1139094228 16:63685013-63685035 CATCTCTGGGATCAGTAATGAGG - Intergenic
1139122065 16:64032582-64032604 CTCCTCAAGAATCAGTGCTGGGG - Intergenic
1140382366 16:74501674-74501696 CTTTTCAGGAATCAGAAATGAGG - Intronic
1140989234 16:80192201-80192223 CCCTTCTGGGATCAGTAATCTGG + Intergenic
1144416540 17:15052996-15053018 CTCCTCAGGAATGCTTAATGAGG - Intergenic
1147615482 17:41824887-41824909 CCCCTCAGGGATCCCTAAAGAGG + Intergenic
1148743997 17:49908371-49908393 CTCCTCTGGCATCAGCAAGGTGG + Intergenic
1150460425 17:65345829-65345851 CTCCACAGGTATCAAAAATGAGG + Intergenic
1151346781 17:73507246-73507268 CTCTGCAGGGATCAGTAGGGTGG + Intronic
1152322002 17:79612912-79612934 CTCCCCAGGGAGAAGAAATGTGG - Intergenic
1153683255 18:7521404-7521426 CTCCTCCCTGCTCAGTAATGTGG + Intergenic
1156791955 18:40986322-40986344 CTCCTGGGTGATTAGTAATGTGG - Intergenic
1157067292 18:44366760-44366782 CTACTCAGGCCTCAGTAATGGGG + Intergenic
1157764586 18:50286870-50286892 CTGCTTAAGGATCCGTAATGGGG - Intronic
1158117865 18:54016585-54016607 CTCATCAAGGAAAAGTAATGGGG - Intergenic
1165159927 19:33810092-33810114 TTCCTCAGGCATGAGTCATGGGG + Intronic
1165530344 19:36394597-36394619 CTCTCCAGGGAGCAGTAAAGGGG - Intronic
1166840065 19:45691925-45691947 CTCCTCAGGCAGCAGCAACGCGG - Exonic
926352715 2:12011431-12011453 CCCTTCAGGGATGAGTAATCTGG - Intergenic
927164928 2:20308508-20308530 CTTCTGAGGGATTAGTATTGGGG + Exonic
930917759 2:56714644-56714666 CACCTCTGTGATTAGTAATGTGG - Intergenic
931224122 2:60314734-60314756 CAACTAAGGGAACAGTAATGGGG - Intergenic
934568433 2:95353276-95353298 TTCCTCTGGGATCAGTTGTGTGG - Intronic
935979275 2:108610508-108610530 CTCCTCAGGGACCAGCCCTGAGG - Intronic
938576046 2:132605722-132605744 CCCCTCAGGGATTCTTAATGGGG - Intronic
941037649 2:160585387-160585409 CCCATCTGGGATCAGCAATGGGG + Intergenic
941763908 2:169275192-169275214 CTCCAAAGGGATGAGGAATGAGG + Exonic
947170013 2:227301379-227301401 CTCATCAGTGATGCGTAATGAGG + Intronic
1175256950 20:57653274-57653296 CACCTCAGGGATCAGTGAGGAGG - Intronic
1177006198 21:15674972-15674994 CTCCAGAGGGATCTGTAATATGG - Intergenic
1179439351 21:41382355-41382377 CCTCACAGGGATCATTAATGAGG + Intronic
1181022987 22:20113220-20113242 CTCTTCAGAGTTGAGTAATGTGG - Exonic
1183736063 22:39645623-39645645 CTCCTCAGTCATCACTGATGAGG + Intronic
1185088400 22:48752943-48752965 CTCCTCAGGTATCAATGGTGGGG - Intronic
950779800 3:15381554-15381576 CTCCTCAGGGGTTAGTTTTGGGG + Exonic
952845020 3:37681052-37681074 CTCTTCACGGATGGGTAATGAGG + Intronic
953541278 3:43820876-43820898 CACATCATGGATCAGCAATGGGG - Intergenic
953986725 3:47449600-47449622 ATCCTCATGGGTCAGGAATGGGG - Intronic
954581384 3:51704585-51704607 CCCTTCAGGGCTCAGGAATGGGG + Intergenic
960565822 3:119130513-119130535 CTACTCAAGCCTCAGTAATGTGG - Intronic
962581851 3:136805065-136805087 CTCCTTAAAGATCATTAATGTGG + Intergenic
963044796 3:141094671-141094693 CTCCTCAGGGTGCAATAACGTGG - Intronic
963534418 3:146510383-146510405 CACCTCAGGGGTCTGAAATGTGG - Intergenic
967257897 3:187611992-187612014 TTCCACAGGGATCAGCATTGAGG + Intergenic
972998534 4:44914824-44914846 CTCCTGAAGGATAAGTAATTAGG - Intergenic
974444482 4:61961632-61961654 CTTCACAGAGATAAGTAATGGGG - Intronic
976854686 4:89589942-89589964 CACCTCAGGGATAAGCACTGGGG - Intergenic
978002352 4:103572079-103572101 CTCTTCAGGGATGAGTCATGTGG + Intergenic
978988359 4:115045475-115045497 CTTCTCAGGGATCATTTCTGTGG - Intronic
979878035 4:125917837-125917859 CTTCTCAGGGAAGAGTAAGGAGG + Intergenic
984964505 4:185128490-185128512 CTCCTCCGGGAACAGTAAAGGGG - Intergenic
987667848 5:20968039-20968061 CTCCCCAGGAACCAGTGATGGGG - Intergenic
988909649 5:35826549-35826571 CTCCACTAGAATCAGTAATGTGG - Intergenic
988997340 5:36727064-36727086 CTCTTGAAGGATCAGTAATGTGG + Intergenic
991360540 5:65815262-65815284 AACCACAGGGATCAGTAATTTGG - Intronic
991413395 5:66367156-66367178 CTCCTGTGAGATCAGTCATGAGG - Intergenic
992810775 5:80386319-80386341 CTCCTCAGGGCTCAGTTCTAAGG - Intergenic
994084896 5:95747328-95747350 CTTCTCAGGGGTGAGGAATGCGG - Intronic
997527673 5:134563859-134563881 ATCCTCAGGCATTAGCAATGGGG + Intronic
1000850401 5:166332810-166332832 CTCCTCAGGGAAATTTAATGTGG + Intergenic
1001069849 5:168576061-168576083 GTCCTAAGGAATCAGTACTGAGG - Intronic
1001691806 5:173638875-173638897 CACTTGAGGGAACAGTAATGGGG + Intergenic
1006552260 6:34834379-34834401 CTCGGCAGGGGTCAGTGATGCGG - Exonic
1009402920 6:63277647-63277669 CTCCACAGGGTACAGTAATAAGG - Intronic
1010356879 6:74944996-74945018 CTGCACAGGGATTAGCAATGGGG + Intergenic
1011431067 6:87287428-87287450 CTTCTCAGGGCTCTGGAATGTGG - Intronic
1014113394 6:117645947-117645969 CTTCTCAAGCCTCAGTAATGGGG - Intergenic
1014433247 6:121393862-121393884 CTCCTCATGTTCCAGTAATGGGG - Intergenic
1015096366 6:129418254-129418276 CTCCCCAGGGAGCAGAAATATGG + Intronic
1019283182 7:210783-210805 CTCCTCAGAGATGAGAAACGGGG - Intronic
1021406963 7:20281782-20281804 CTCCTCAGCTTTCAGTAAAGGGG + Intergenic
1024157358 7:46638910-46638932 CTCTTAAGGGATAAGTAGTGGGG + Intergenic
1027270124 7:76514374-76514396 CACCTCAGGGGTCATTGATGGGG + Intronic
1030480111 7:110092664-110092686 CTTCTCAGGGATCAGTCCTGTGG - Intergenic
1032874774 7:136026477-136026499 CTCCTCAGGAATCTGGAATTGGG + Intergenic
1032985384 7:137331474-137331496 CTCCTCTGCGATCGGGAATGTGG + Intronic
1033981859 7:147175001-147175023 CATCTCAGGGATTATTAATGGGG + Intronic
1042062541 8:64836851-64836873 ATCCTCATGCAGCAGTAATGAGG - Intergenic
1042669134 8:71241752-71241774 CTCATCAGGGAGAAGTGATGTGG - Intronic
1044413429 8:91910034-91910056 CTCCTCAGGGAGGAGGAAAGGGG + Intergenic
1048153200 8:131914424-131914446 ATCCTCAGGAATCAACAATGAGG - Intronic
1055813785 9:80181617-80181639 CTGCTCAGGAGTCAGTCATGTGG + Intergenic
1057460328 9:95254903-95254925 CTTCTCAAGCCTCAGTAATGGGG - Intronic
1059893871 9:118837285-118837307 CTCCACTGGGATCAGAAATGAGG - Intergenic
1187244280 X:17539789-17539811 CTCCTCAGTGCTCTTTAATGGGG + Intronic
1189473835 X:41334243-41334265 CTCTTCAGGGATGAGTCATGTGG + Exonic
1189685069 X:43555465-43555487 CTCCTCAGGGTGCAGCAAGGTGG + Intergenic
1192763566 X:74121002-74121024 CTCTTCAGGGATGAGTCATGTGG + Intergenic
1193038506 X:76979305-76979327 CTGCTCAGGGGTCAGTAGTCAGG - Intergenic
1193118652 X:77800173-77800195 TTCCTCAAGGATCTGTAATTAGG - Intergenic
1194895565 X:99435399-99435421 CTCCTAGGGGTTCAGTTATGGGG - Intergenic
1195004886 X:100676162-100676184 CTCCTCAGGGATCAGTAATGGGG - Exonic
1197350125 X:125372564-125372586 CTACTCAAGCCTCAGTAATGGGG + Intergenic
1198286366 X:135195241-135195263 CTCAGCAGGGATCAGTTTTGTGG + Intergenic
1199969638 X:152850059-152850081 CTCTCCTGGGATCAGTAAGGAGG - Intronic
1201338417 Y:12904927-12904949 CTCTTCAGGGATGAGTCATGTGG + Exonic