ID: 1195006712

View in Genome Browser
Species Human (GRCh38)
Location X:100692351-100692373
Sequence ACATCAGTAAATAAGATACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195006712 Original CRISPR ACATCAGTAAATAAGATACG TGG (reversed) Intronic
901126505 1:6932780-6932802 ACTTCACTAAAGAAGATACATGG - Intronic
907146877 1:52242691-52242713 CCATCAGTACATAAGAAACTAGG - Intronic
909371523 1:74888363-74888385 ACATCAAAAAATAACAGACGTGG + Intergenic
909505840 1:76388808-76388830 ACTGCACTAAATAAGATACTTGG - Intronic
909615159 1:77600480-77600502 AGTTAAGTAAATAAAATACGAGG + Intronic
910901337 1:92124415-92124437 ACAGCAGTAAATGAGATACACGG - Intronic
911794170 1:102055230-102055252 AAACCAGTAAATAAAATACTGGG + Intergenic
914191010 1:145410613-145410635 ACTTCAGAAAAGAAGATACATGG - Intergenic
916868804 1:168889152-168889174 AAACCAGTAAATAAAATACTGGG + Intergenic
917705646 1:177631542-177631564 CCATCATTGAAAAAGATACGAGG + Intergenic
919058339 1:192599037-192599059 ACATCAGAATATAAGATATAAGG - Intergenic
924193155 1:241577689-241577711 AACTCAGTAAATAAAATACTGGG - Intronic
924844946 1:247757743-247757765 AGATAAGTCCATAAGATACGAGG + Exonic
1065714433 10:28551599-28551621 ATAACAGTAAATAAGATAAAAGG - Intronic
1068161700 10:53272584-53272606 AGCTCAGTAAATAAAACACGAGG + Intergenic
1068838357 10:61581218-61581240 GCATCAGTAATTTAGATACCTGG - Intergenic
1069295206 10:66835489-66835511 ATATCAGTAAATATGATAACAGG - Intronic
1071194948 10:83147813-83147835 AAATAAGTAAATAGGATAGGAGG + Intergenic
1075639408 10:124053988-124054010 ACATCAGAAAATAACACACCAGG + Intronic
1076082017 10:127590848-127590870 ACATCACCAAATCAGATACAGGG - Intergenic
1077645155 11:3917006-3917028 ACATCAGTGGATCAGATCCGAGG - Intronic
1077948583 11:6929413-6929435 ACATCAGTAAAAAAGACATTAGG - Intronic
1078384885 11:10881043-10881065 ACATTAGTGAGGAAGATACGAGG + Intergenic
1079291241 11:19189776-19189798 AAATCAGTAAATAAAATAATTGG + Intronic
1080733729 11:34988389-34988411 ACATCACTTAATAAGATTTGGGG - Intronic
1080888136 11:36385328-36385350 AGATGAGTAAATAAGATGTGTGG + Intronic
1080974880 11:37326802-37326824 TCAACAGAAAATAAAATACGAGG - Intergenic
1088413963 11:109568777-109568799 AACTCAGTAAATAAAATACTGGG - Intergenic
1089232099 11:116987491-116987513 ACATCAGTAAACAAGATCCTTGG + Intronic
1092175544 12:6403056-6403078 ACTTCAGAAAATAAAATACCTGG - Intergenic
1093588929 12:20876150-20876172 ACATCAGTAATTAAGATATTTGG + Intronic
1094638860 12:32253934-32253956 ACAGCAGTAAATATGACAGGTGG - Intronic
1094774327 12:33706157-33706179 ACATCATTAAATTAGGTAAGTGG + Intergenic
1095339816 12:41076145-41076167 ACAGCAGTAGGTCAGATACGTGG + Intergenic
1097780974 12:63704093-63704115 ACATCAGGAAGAAAGATACCCGG + Intergenic
1098216366 12:68224535-68224557 ACATAAGTAAATAAGAAAAAGGG + Intronic
1098822476 12:75250328-75250350 AAAACAGTAAATAAGACATGGGG - Intergenic
1099165481 12:79301517-79301539 TCATCGGTAAGTAAGATAAGGGG - Intronic
1105786851 13:23758571-23758593 ACATCAGTAAATCAGTTTCAGGG - Intronic
1106206432 13:27600523-27600545 ACATTAATATATAAGATACTGGG + Intronic
1109001682 13:56812617-56812639 AAACCAGTAAATAAAATACTGGG + Intergenic
1111988316 13:95088321-95088343 ATATCAGTTATTAAGATAAGTGG - Intronic
1112068803 13:95825206-95825228 AACTCAGTAAATAAAATACTGGG - Intronic
1112733943 13:102396896-102396918 ACCTCAGTAAATAAGCTTCCTGG + Intronic
1113538539 13:111087186-111087208 ACTTCACTAAAGAAGATATGTGG - Intergenic
1114132411 14:19807078-19807100 AAATAAGTAAATAAGATAAGAGG + Intronic
1114828840 14:26113558-26113580 GCATCAGTACAGAATATACGAGG + Intergenic
1115663236 14:35518459-35518481 AAATAAGTAAATAAGAAACTAGG - Intergenic
1116377029 14:44216072-44216094 ACATTAGAAAATAATATACCAGG + Intergenic
1119790118 14:77342443-77342465 AAAGCAGCAAATAAGATACAAGG + Intronic
1120176604 14:81300459-81300481 ACATCAGTAAAAAAGTTAAAAGG + Intronic
1120472428 14:84942933-84942955 AAATAAGTAAATAAAATACAAGG + Intergenic
1122332373 14:100931200-100931222 AAATCAGTAAATAATATTCCAGG + Intergenic
1128487397 15:68107842-68107864 CCACCAGTAAATACGATACATGG + Intronic
1129106713 15:73314597-73314619 ACCTCAATAAAGAAAATACGAGG + Intergenic
1130742650 15:86617662-86617684 ACATAAGTATATAATATACTAGG + Intronic
1131679571 15:94707337-94707359 AGATCAGTAACTATGAGACGAGG - Intergenic
1131892325 15:96985379-96985401 ATATCAATAAATAAGATTAGGGG - Intergenic
1135690929 16:24537078-24537100 ACATAAGAAAATAAGTTAAGGGG + Intergenic
1140464535 16:75169629-75169651 ACATCAGAAAATAAAAAACTTGG + Exonic
1141010600 16:80394234-80394256 ACATCACTGAAAGAGATACGAGG + Intergenic
1141367715 16:83458620-83458642 AAATCAGTAAATAAGTTACAAGG - Intronic
1142424030 16:89991266-89991288 TCATCAATGAATAAGATACATGG - Intergenic
1142452067 16:90181086-90181108 AGATAAGTAAATAATATACTAGG - Intergenic
1143030796 17:3965828-3965850 AAATCAATAAATAAAATACCAGG - Intergenic
1143434870 17:6915862-6915884 AAACCAGTAAATAAAATACTGGG + Intronic
1145258104 17:21338589-21338611 AGATCAGTAGATAAGCGACGAGG - Intergenic
1145318530 17:21749417-21749439 AGATCAGTAGATAAGCGACGAGG + Intergenic
1146091857 17:29887132-29887154 ATATAATTAAATAAGATAGGTGG - Intronic
1146209981 17:30934695-30934717 ACATCAATATATAATATACCAGG + Intronic
1146707981 17:35015800-35015822 AAATCAGTAATGAAGATATGAGG + Intronic
1153420421 18:4899093-4899115 AAATCAGTAATTAAGATTTGTGG + Intergenic
1156768647 18:40690901-40690923 ACTTCAGTAAATGAGATACTAGG - Intergenic
1159149306 18:64499870-64499892 ACATAAATAAATAAAATATGAGG + Intergenic
1159728268 18:71991634-71991656 ACTTCACTAAAAAAGATACACGG + Intergenic
1159730862 18:72025745-72025767 ACATCACTAAATAAAAGACAAGG - Intergenic
925247408 2:2396316-2396338 AAATCTGTGAATAAGATACATGG + Intergenic
925827503 2:7863870-7863892 ACATCAGGAAATCAGAGACCAGG + Intergenic
926599608 2:14828128-14828150 ACAGCAGTAAATAAATTAGGTGG + Intergenic
929846955 2:45540721-45540743 ACCTCACTAAAGAAGATACATGG + Intronic
930794579 2:55375081-55375103 ACTTCAGTTAATAATATATGAGG + Intronic
937737466 2:125309924-125309946 ACAGCAGCAAATAACATACCTGG - Intergenic
939455120 2:142423958-142423980 ACATCAGAAACTAAGATTTGGGG - Intergenic
939476554 2:142694572-142694594 AAATCAGCAAATAAAATACTGGG + Intergenic
940291376 2:152080599-152080621 AAATCAGTGAATAAGATTAGTGG + Intronic
942587494 2:177498784-177498806 AGATAAGTATATAAGATATGAGG - Intronic
943169739 2:184383100-184383122 CCATCAGTTTATAAGATAGGTGG + Intergenic
944875042 2:203954968-203954990 ACATCAGTAAAGCAGATAAAAGG - Intronic
945543064 2:211113036-211113058 CAATAAGTAAATAAGATAAGAGG - Intergenic
946480108 2:220047325-220047347 ACATCAGTGGATAAGATATTGGG + Intergenic
948961389 2:241341200-241341222 ACAACAAGAAATAAGATACCTGG - Intronic
1169445417 20:5667308-5667330 ACACCAGCAAATAAGATGAGTGG - Intergenic
1171145197 20:22775122-22775144 ACATCAAGAAATAAGATACTGGG + Intergenic
1174288159 20:49486634-49486656 ACATCTGTAAATAAGAGATGAGG + Intergenic
1174866023 20:54136357-54136379 AGTTCTGTAAATAAGATAAGTGG - Intergenic
1182771374 22:32799027-32799049 ACATCACTTAATAAGCTAGGTGG - Intronic
949298957 3:2560988-2561010 ACATCAGAAAATCAGATAACTGG - Intronic
951858971 3:27229058-27229080 AACTCAGTAAATAAAATACTAGG + Intronic
955836046 3:63056556-63056578 ACATCAGTAAAGAGGAAAAGAGG + Intergenic
957273713 3:78063499-78063521 ACATCACTCCATAAGATAGGAGG - Intergenic
957281512 3:78155890-78155912 AAACCAGTAAATAAAATACTGGG + Intergenic
958524338 3:95235534-95235556 ATATCATCAAATAAGACACGAGG + Intergenic
960578148 3:119247005-119247027 AACTCAGTAAATAAAATACTGGG + Intergenic
960761938 3:121081641-121081663 AATTCAGTAAATAAAATACTAGG - Intronic
965415948 3:168392410-168392432 AAATCTGTAAAAAAGATACTGGG + Intergenic
967058970 3:185854614-185854636 ACATCAGAAAATAAGTTAATTGG + Intergenic
967246601 3:187492652-187492674 AAATCAGTAAATAAAACACTGGG + Intergenic
967308318 3:188081517-188081539 ACATGAGAAAATGAGATATGAGG - Intergenic
970166499 4:13243515-13243537 GCATCAGTAAATTAGATTAGTGG + Intergenic
970209609 4:13695690-13695712 ACTTCAATAAATAAGATGAGTGG + Intergenic
971721127 4:30246640-30246662 AAGTCAGTAAATAAAATACTGGG - Intergenic
971721794 4:30255068-30255090 AAACCAGTAAATAAAATACAGGG - Intergenic
973091710 4:46146101-46146123 AACTCAGTAAATAAAATACTGGG - Intergenic
974848389 4:67379138-67379160 AACTCAGTAAATAAAATACTGGG + Intergenic
975417162 4:74118026-74118048 ACAACAGTAAATAGGATATATGG - Intronic
975858036 4:78645743-78645765 ACATAAGTAAGTATGATACAAGG + Intergenic
976915481 4:90369061-90369083 AAATCAGTAAATAATATCTGTGG + Intronic
979260950 4:118644028-118644050 AGATAAGTAAATAATATACTAGG - Intergenic
979434811 4:120675008-120675030 AACTCAGTAAATAAAATACTGGG + Intergenic
979598167 4:122557151-122557173 TCATCAGTCACTAAGATAGGTGG - Intergenic
983400966 4:167265014-167265036 ACAACAGTAAAAAAGATCAGTGG - Intergenic
984408553 4:179366288-179366310 AGATCAATAAAGAAGATAAGTGG + Intergenic
984879854 4:184401204-184401226 ACTTCAGAAAATAAAATACTTGG - Intronic
987582284 5:19809760-19809782 ACAGCAGTTAAAAAGATAAGTGG + Intronic
989593851 5:43137187-43137209 ACAACAGAAAATAAGACAGGTGG + Intronic
994496446 5:100518594-100518616 AAATCAGTGAATAAGATCCTAGG + Intergenic
994752922 5:103761237-103761259 ACTTCAGGAAATAAGAAAAGTGG - Intergenic
996110226 5:119556631-119556653 AACTCAGTAAATAAAATACTGGG + Intronic
996219270 5:120909752-120909774 ACTTCAGTAAATAAGACTAGAGG - Intergenic
1000237740 5:159377844-159377866 AACTCAGTAAATAAAATACTGGG + Intergenic
1002057032 5:176604082-176604104 ACAGCAGTGAATAAGAAATGTGG + Intronic
1006737788 6:36286990-36287012 AAATAAGTAAATAAGATGCTGGG - Intronic
1010637673 6:78281810-78281832 AAACCAGTAAATAAAATATGGGG - Intergenic
1013195563 6:107842226-107842248 AAATCAGTAAGTAAGATATTTGG - Intergenic
1019107778 6:169683312-169683334 AAATAAGTAAATAACATACAAGG + Intronic
1020268375 7:6577083-6577105 ACATAAGTAAATAAGAAAATAGG + Intergenic
1023020191 7:36005004-36005026 TCATCAGTAAATAAGAGATCAGG + Intergenic
1024440572 7:49412324-49412346 ACATTAGAAAATAAGATAGATGG + Intergenic
1025638677 7:63348467-63348489 ACAGAAGAAAATAAGCTACGAGG - Intergenic
1025644019 7:63399622-63399644 ACAGAAGAAAATAAGCTACGAGG + Intergenic
1029321549 7:99765719-99765741 ACTTCAGTAAAAAACATACATGG + Intronic
1031252090 7:119397501-119397523 AAATCAGCAAATCAGATAAGGGG - Intergenic
1032437907 7:131916622-131916644 ACAACAGCAAAAAAGATACTAGG + Intergenic
1033491864 7:141852311-141852333 AAACCAGTAAATAAAATACGGGG - Intergenic
1033672207 7:143504108-143504130 ACAACAGTAGCAAAGATACGAGG + Intergenic
1033842292 7:145389295-145389317 ACATCAGTAATTAAGATAAACGG + Intergenic
1036827431 8:11988068-11988090 AAATTAGTAAATAAAATACTGGG + Intergenic
1041187423 8:55315393-55315415 AAATAAGTAAATAAGATGTGTGG + Intronic
1043366610 8:79540488-79540510 ATATCAGTATTTAAGATAAGAGG - Intergenic
1044746518 8:95376289-95376311 GCAACAGTAAATAAGACATGAGG + Intergenic
1045001569 8:97882923-97882945 ACATCACCAAAGAAGATACACGG - Intronic
1046284638 8:112079360-112079382 AACTCAGTAAATAAAATACTGGG - Intergenic
1046513726 8:115231594-115231616 ACATGAATAAATAGGATATGAGG - Intergenic
1047529809 8:125664602-125664624 ACATGGGTAAATAAGATAATAGG - Intergenic
1047551759 8:125881294-125881316 GTATCAGTAGATAAGATACTAGG - Intergenic
1050114772 9:2252555-2252577 TCATAAGCAAATAAGATACTTGG - Intergenic
1054835242 9:69670210-69670232 ATATCATTAAATAAGATACATGG + Intronic
1059397640 9:114048300-114048322 TCTTCAGGAAATAAGATACATGG - Intronic
1061732431 9:132626279-132626301 CCATCAGTAATTAAGAGATGGGG - Intronic
1187834124 X:23413671-23413693 AAATCAGTAAATTAGAGACTAGG + Intergenic
1188381730 X:29502599-29502621 AAATCAATAAATACGATACAAGG - Intronic
1189734351 X:44054287-44054309 ATATCAGTAAATAAAATAGAAGG - Intergenic
1189976941 X:46470823-46470845 AAATCAATAAAAAAGATACTTGG - Intronic
1191770395 X:64750327-64750349 AACTCAGTAAATAAAATACTGGG - Intergenic
1193301006 X:79888057-79888079 AACTCAGTAAATAAAATACTAGG + Intergenic
1193460822 X:81789478-81789500 AAACCAGTAAATAATATACTGGG - Intergenic
1193626071 X:83821389-83821411 AACTCAGTAAATAAAATACTGGG - Intergenic
1194490730 X:94545277-94545299 ATTTCAGTAAATAAAATAAGTGG - Intergenic
1195006712 X:100692351-100692373 ACATCAGTAAATAAGATACGTGG - Intronic
1196748622 X:119094628-119094650 ACATCAATAAATAAGGGACCAGG + Intronic
1197674446 X:129314326-129314348 ACATCATTTAATAATAAACGTGG + Intergenic
1198481658 X:137046854-137046876 CCATCAAGAAATAAGATACCAGG - Intergenic
1198611741 X:138409405-138409427 ATATCAGAAAATAAGATTAGTGG - Intergenic