ID: 1195007620

View in Genome Browser
Species Human (GRCh38)
Location X:100701708-100701730
Sequence CAGGATATGCATAGATTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 162}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195007616_1195007620 2 Left 1195007616 X:100701683-100701705 CCCAAAACAGAAGCGTAAGTGGA 0: 1
1: 0
2: 0
3: 6
4: 119
Right 1195007620 X:100701708-100701730 CAGGATATGCATAGATTGGATGG 0: 1
1: 0
2: 1
3: 7
4: 162
1195007613_1195007620 12 Left 1195007613 X:100701673-100701695 CCTGCCAAGACCCAAAACAGAAG 0: 1
1: 0
2: 1
3: 18
4: 475
Right 1195007620 X:100701708-100701730 CAGGATATGCATAGATTGGATGG 0: 1
1: 0
2: 1
3: 7
4: 162
1195007614_1195007620 8 Left 1195007614 X:100701677-100701699 CCAAGACCCAAAACAGAAGCGTA 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1195007620 X:100701708-100701730 CAGGATATGCATAGATTGGATGG 0: 1
1: 0
2: 1
3: 7
4: 162
1195007617_1195007620 1 Left 1195007617 X:100701684-100701706 CCAAAACAGAAGCGTAAGTGGAT 0: 1
1: 0
2: 0
3: 6
4: 145
Right 1195007620 X:100701708-100701730 CAGGATATGCATAGATTGGATGG 0: 1
1: 0
2: 1
3: 7
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195007620 Original CRISPR CAGGATATGCATAGATTGGA TGG Intronic
900812237 1:4815461-4815483 CAGAATATGGATAGATGTGATGG + Intergenic
901412130 1:9091783-9091805 CAGGATATGCCATCATTGGAGGG + Intergenic
904263776 1:29306162-29306184 CAGGACTTGGATGGATTGGAGGG + Intronic
904790420 1:33016178-33016200 GAGGATATGCATAGGTTATATGG - Intronic
906763243 1:48399767-48399789 CAGGATCAGCACAGATAGGAAGG - Intronic
907372298 1:54011363-54011385 CAGGGGATGCAAGGATTGGAAGG - Intronic
912259559 1:108096852-108096874 CAGGATCTGCAAAGCCTGGAAGG + Intergenic
915356436 1:155257710-155257732 TAGGATGAGCATAGATGGGAAGG - Intronic
915883293 1:159696819-159696841 CAAGACATGAATAAATTGGAGGG - Intergenic
916021750 1:160798698-160798720 CAGAATATGCAGACACTGGAAGG - Intronic
919726734 1:200889387-200889409 CAGGACTTCCACAGATTGGAGGG - Intergenic
921109285 1:212016627-212016649 CAGGATCAGCATAGATTAGTTGG - Intronic
921330533 1:214031236-214031258 GAAGATATGCATAAATTTGAAGG - Intronic
922515888 1:226208126-226208148 CAGGAGATGCATGGAATGGAGGG + Intergenic
923541267 1:234889903-234889925 CAGGACAAGCAAGGATTGGAGGG + Intergenic
1066758513 10:38733505-38733527 CAAAATATGCATATATAGGAAGG + Intergenic
1066963140 10:42239252-42239274 CAAAATATGCATATATAGGAAGG - Intergenic
1068038728 10:51795266-51795288 CACCATATTCATACATTGGAAGG - Intronic
1070007017 10:72434395-72434417 CATGAACTGCATAGATTGGTTGG - Intronic
1075891372 10:125954094-125954116 CAGGTTCTGCTTAGATTGTACGG - Intronic
1078318582 11:10312435-10312457 TAGGATATGTATAGATTTGTTGG - Intronic
1081280042 11:41198230-41198252 CAGGAAATGCATATATTTCATGG - Intronic
1083988983 11:66235103-66235125 GAGGAACTGCAAAGATTGGAAGG + Intronic
1084930799 11:72554072-72554094 CAGGACATAGATAGATGGGAGGG - Intergenic
1085298752 11:75446077-75446099 CAGGATATTCAGAGATGGGTGGG - Intronic
1087588573 11:100154651-100154673 GAGGATGTGGAGAGATTGGAGGG - Intronic
1091268819 11:134291243-134291265 GAGGATGTGCATAGGTTGCATGG - Intronic
1092936239 12:13366900-13366922 CAGGGTATCCATAGATTTGCTGG + Intergenic
1093278821 12:17165020-17165042 GAGGATATGCATAGATTATATGG + Intergenic
1096354649 12:50930120-50930142 CAGCATATCCATAGATATGAGGG - Exonic
1104130347 12:125887588-125887610 CAGGATATGCATATTTTTAAAGG - Intergenic
1105741057 13:23323411-23323433 CAGGTTGTTAATAGATTGGAAGG + Intronic
1111137487 13:84067404-84067426 CAGGCAATGCAGAGATTAGAAGG + Intergenic
1112890581 13:104225404-104225426 TAGAATATGCATACATTTGAAGG - Intergenic
1114458824 14:22874055-22874077 CAGGACATGCAATGAATGGAAGG - Intronic
1116874873 14:50101007-50101029 CAGGAGAGGCATAGTTTGGCTGG - Intergenic
1131821254 15:96276559-96276581 CAGGATATGTCAAGATTAGATGG + Intergenic
1133482734 16:6186839-6186861 CAGAATATGCAGAGAATGTAGGG + Intronic
1135014276 16:18911025-18911047 GACTATTTGCATAGATTGGAGGG - Intronic
1135817944 16:25653014-25653036 CAGCATGTGCAGAGATTGCATGG + Intergenic
1136719283 16:32307341-32307363 CAAAATATGCATACATAGGAAGG - Intergenic
1136724309 16:32345707-32345729 CAAAATATGCATATATAGGAAGG - Intergenic
1136837653 16:33513605-33513627 CAAAATATGCATACATAGGAAGG - Intergenic
1136842636 16:33551751-33551773 CAAAATATGCATATATAGGAAGG - Intergenic
1139322844 16:66129354-66129376 CAGGATTTAAATAGATTGCAGGG - Intergenic
1203002121 16_KI270728v1_random:172058-172080 CAAAATATGCATATATAGGAAGG + Intergenic
1203007148 16_KI270728v1_random:210430-210452 CAAAATATGCATACATAGGAAGG + Intergenic
1203133724 16_KI270728v1_random:1708465-1708487 CAAAATATGCATATATAGGAAGG + Intergenic
1203147838 16_KI270728v1_random:1813883-1813905 CAAAATATGCATATATAGGAAGG - Intergenic
1203152801 16_KI270728v1_random:1852048-1852070 CAAAATATGCATATATAGGAAGG - Intergenic
1147986031 17:44308422-44308444 CGGGAGAAGCAGAGATTGGAAGG - Intronic
1148653507 17:49266529-49266551 CAGGCTATGCCAAGATTTGAAGG - Intergenic
1150918464 17:69459755-69459777 CAAGAAATACATAGATTGCAAGG + Intronic
1160808374 19:1002221-1002243 CAGGATATATATATATTGGCTGG + Intronic
1161633209 19:5369907-5369929 CAGGTTGTGAATAGATTTGAAGG - Intergenic
1165885731 19:39076811-39076833 CAGGTTCTGGATAGATTGGAAGG + Intergenic
927759708 2:25742045-25742067 CAGGAGACGCACAGTTTGGAGGG + Exonic
928722573 2:34137466-34137488 AAGGATATGCATAGATTACACGG + Intergenic
930052228 2:47225408-47225430 AAGGAGTTGCAAAGATTGGAAGG - Intergenic
930212937 2:48661774-48661796 CAGGATATGAATAGGTTGGAAGG - Intronic
930590672 2:53322930-53322952 TGGGATATTCATATATTGGAAGG - Intergenic
930774168 2:55156533-55156555 CAGGATTTGCATAAATGGAAAGG - Intergenic
934321833 2:91977854-91977876 CAAAATATGCATATATAGGAAGG + Intergenic
934604700 2:95685611-95685633 CAAGAAATACATTGATTGGAGGG - Intergenic
934626288 2:95857805-95857827 CTGGATCTGCATAGAAAGGAAGG - Intronic
934807275 2:97243511-97243533 CTGGATCTGCATAGAAAGGAAGG + Intronic
934830234 2:97513676-97513698 CTGGATCTGCATAGAAAGGAAGG - Intronic
936489518 2:112958195-112958217 CAGGAAAGGCCTAGATTGGGGGG - Intergenic
937917409 2:127105992-127106014 CAGGAAATGCAGAGATTGAGGGG - Intronic
939087963 2:137744172-137744194 TAGGATATGCATACATTTTAAGG + Intergenic
940305380 2:152220371-152220393 CAGGATATATATAGATTGAAAGG + Intergenic
940914148 2:159236354-159236376 CCTGAAATGCATTGATTGGATGG + Intronic
942149597 2:173061988-173062010 CAGGATATGAAGAGAAAGGAAGG - Intergenic
943366100 2:186968952-186968974 AAGCATATGCACAGACTGGATGG - Intergenic
945763258 2:213941742-213941764 CAGTATATGAATAAAATGGAAGG - Intronic
1170598461 20:17822908-17822930 CAGGATGTGCATGGATTAAATGG - Intergenic
1172422759 20:34831361-34831383 CAGAAAATGCAAAGATTGGCCGG - Intergenic
1172788754 20:37487790-37487812 CAGGATTTGCTGGGATTGGATGG - Intergenic
1177043426 21:16141274-16141296 CAAGAAATGCCTATATTGGAGGG - Intergenic
1177780298 21:25614983-25615005 CAGGATAGGTCAAGATTGGATGG - Intergenic
1178031718 21:28535279-28535301 CTGGATCTGCAAAGAATGGAAGG + Intergenic
1178508098 21:33179491-33179513 GAGGATAAGCATAGATGGGTGGG - Intergenic
1179339761 21:40494325-40494347 AAGGACATGCATAGACTGAAAGG + Intronic
1180151929 21:45952982-45953004 AAAGAAATGCAAAGATTGGAAGG - Intergenic
1180548574 22:16523771-16523793 CAAAATATGCATATATAGGAAGG + Intergenic
1181442750 22:22945189-22945211 GAGGATATTCATGGATTGAAAGG - Intergenic
1182210877 22:28676663-28676685 CAAAATATGCATATATAGGAAGG - Intronic
1182467895 22:30529251-30529273 CAGGATATGCATGAGTTGGGGGG - Intronic
1185005472 22:48274042-48274064 ATGGATATGGATAGATTGGTGGG - Intergenic
949109507 3:242055-242077 TAGGATATACATATAGTGGAGGG - Intronic
949537738 3:5008774-5008796 CAGCATATGCAAAGATCAGATGG - Intergenic
952582925 3:34855657-34855679 CAGGCTCTGCATTGATTGGTTGG + Intergenic
952855243 3:37764817-37764839 CCAGCTATGCAAAGATTGGAGGG - Intronic
954470237 3:50687758-50687780 CAGTATATGCATAGATGGAATGG - Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
957578991 3:82046406-82046428 GGGGATATAAATAGATTGGAAGG - Intergenic
959908347 3:111734796-111734818 GTGGATAAGCATAAATTGGAGGG + Intronic
960962829 3:123084126-123084148 CAGGATTTGCCTAGAGTGGCAGG - Intronic
962327669 3:134449437-134449459 CAGGAAACACAGAGATTGGAAGG - Intergenic
963156614 3:142105081-142105103 CAGAATATGTATAAACTGGAGGG - Intronic
967112046 3:186302373-186302395 CAGTCTATGTATAGATTGAATGG + Intronic
967367951 3:188709153-188709175 CATTATATTCATGGATTGGAAGG - Intronic
968986180 4:3875723-3875745 TAGCATTTGCATAGAATGGAGGG + Intergenic
970239985 4:13999102-13999124 CAGGATTTGCAAAGCTTTGAAGG + Intergenic
970734301 4:19148180-19148202 CAGGATATGGACATATTTGAGGG + Intergenic
975286732 4:72630056-72630078 CATGATCTGCACATATTGGAAGG - Intergenic
979515046 4:121598090-121598112 CAGAATATGCAAATATTGGGAGG - Intergenic
982224768 4:153155402-153155424 AAGAATATGCAGAAATTGGAGGG + Intronic
983463723 4:168059630-168059652 CATGATATGCTTTCATTGGAAGG + Intergenic
986605065 5:9514544-9514566 GAGGATATGCATAGGTTATATGG - Intronic
988019868 5:25608691-25608713 TAGGAGATGCACAAATTGGAAGG - Intergenic
992252370 5:74888036-74888058 AGAGAGATGCATAGATTGGATGG - Intergenic
993895725 5:93531381-93531403 GAGGATACGCATAGGTGGGAAGG - Intergenic
995637303 5:114208409-114208431 CAGCATTAGCATAGAGTGGAGGG - Intergenic
998012296 5:138704845-138704867 CAGGAGATGCAGAGATGGGGAGG - Intronic
998696524 5:144646832-144646854 CAGGATATGCAGCCATTTGATGG + Intergenic
999410158 5:151343539-151343561 CAGGATGTGCATACAGTGGCAGG + Exonic
1000385849 5:160674133-160674155 CAGGATTTGCTCAGAGTGGAAGG - Intronic
1001253940 5:170169437-170169459 CAGGACAGGCATCCATTGGAGGG + Intergenic
1004782634 6:18928264-18928286 CAAGAAATACATAGAATGGAAGG - Intergenic
1005811199 6:29517756-29517778 CTGGATATGCAGACATAGGAAGG - Intergenic
1005893928 6:30162454-30162476 CAGGAAGAGCAGAGATTGGATGG + Intergenic
1009643378 6:66366189-66366211 CACCATATACATGGATTGGAAGG + Intergenic
1009803390 6:68571629-68571651 CAGGATATGCAATTATTGGTTGG + Intergenic
1009926525 6:70127252-70127274 CAGGTCATGCAGAGATTTGAAGG + Intronic
1010588217 6:77680611-77680633 CAGAAGATGTATAGAATGGAAGG + Intergenic
1010739831 6:79487731-79487753 CAGAATATGGATAAATTGCAAGG - Exonic
1011417238 6:87134563-87134585 GAGGATATGCATAGGTTATATGG - Intergenic
1012262172 6:97100339-97100361 AAGGATATACATAAATTTGATGG - Intronic
1014871813 6:126605412-126605434 GAGGATTTGAACAGATTGGATGG - Intergenic
1015760965 6:136660032-136660054 CAGTATATGCATAAATTAAAAGG + Intronic
1018359144 6:163048155-163048177 AAGTACATGCAAAGATTGGAAGG - Intronic
1023640073 7:42248651-42248673 GAGGATATGCATATAGTAGATGG + Intergenic
1024775912 7:52785293-52785315 CAGAAAATGCAAAGATTGGTTGG - Intergenic
1028600764 7:92598039-92598061 CAGGAGAAGCATATCTTGGAGGG - Intergenic
1028702670 7:93799708-93799730 TAGAATATGGAGAGATTGGAAGG + Intronic
1028847632 7:95500061-95500083 CAGAATATTTATAGATTTGATGG + Intronic
1035133967 7:156682064-156682086 AAGGATATGCATGGGGTGGAAGG - Exonic
1036456212 8:8910559-8910581 CAAGAAAAGAATAGATTGGAAGG + Intergenic
1037488230 8:19370606-19370628 AAGGACATGCATAGTCTGGAAGG - Intronic
1038408462 8:27340386-27340408 CAGCATATGCAAAGATAAGAAGG + Intronic
1040852917 8:51920561-51920583 GAGCACTTGCATAGATTGGAAGG - Intergenic
1041163012 8:55063972-55063994 CAGGATATTCAGAGATGGAAAGG - Intergenic
1041692711 8:60704548-60704570 CACCATGTGCATAGATTGGAAGG + Intronic
1045392683 8:101731182-101731204 CAGGATGTGGCTAGAGTGGAGGG + Intronic
1046595486 8:116256268-116256290 CAGGTTATCCACAAATTGGAGGG - Intergenic
1046647516 8:116802222-116802244 TAGGATATGGAGATATTGGAGGG + Intronic
1048506551 8:135027046-135027068 CAACACATGCATAGAGTGGAGGG - Intergenic
1049723641 8:144134521-144134543 CAGCATATGCATTTTTTGGAGGG + Intergenic
1050371601 9:4927352-4927374 CAGGATTTGCAGAGACGGGAAGG - Intergenic
1052494245 9:29207093-29207115 CAGCATATGCATACATAGGGAGG - Intergenic
1053280376 9:36816636-36816658 CAGGATATGCTCAAGTTGGAGGG + Intergenic
1053532033 9:38892001-38892023 CAGGATCTCAACAGATTGGATGG - Intergenic
1054204258 9:62116410-62116432 CAGGATCTCAACAGATTGGATGG - Intergenic
1054634105 9:67471954-67471976 CAGGATCTCAACAGATTGGATGG + Intergenic
1055303542 9:74905831-74905853 CAGAATTTGAATAGATTGCAAGG - Intergenic
1055715188 9:79109776-79109798 CAGTATATGCATATAATGAAAGG + Intergenic
1056314968 9:85379423-85379445 GAGGATTTCCATAGACTGGAAGG + Intergenic
1203759685 EBV:5700-5722 CAGTGTATGCATAGTCTGGAAGG - Intergenic
1203583158 Un_KI270746v1:33522-33544 CTGGATCTGCATAGAAAGGAAGG + Intergenic
1186794443 X:13030744-13030766 CAGTAGATGAATAGATTGAATGG + Intergenic
1189768787 X:44400947-44400969 AAGGATATGTATGGATGGGAAGG + Intergenic
1192986909 X:76409472-76409494 CAGGAAGTGCAAAGATTAGAGGG + Intergenic
1193862915 X:86693347-86693369 CAGTATATGTAAAGATTGAAGGG - Intronic
1194067459 X:89279049-89279071 CAGGATATGAAAATTTTGGATGG - Intergenic
1195007620 X:100701708-100701730 CAGGATATGCATAGATTGGATGG + Intronic
1195645653 X:107228142-107228164 AAGGATATTCAGAGATGGGAGGG + Intronic
1199573592 X:149291632-149291654 CAGAATAACCATAGACTGGATGG - Intergenic
1200721616 Y:6613258-6613280 CAGGATATGAAAATTTTGGATGG - Intergenic
1200894912 Y:8364972-8364994 CAGAATATGCATTGATTTAATGG - Intergenic
1201542479 Y:15121591-15121613 GAGGATATGCATAGGTTATATGG + Intergenic