ID: 1195009058

View in Genome Browser
Species Human (GRCh38)
Location X:100717404-100717426
Sequence CTGGATAAGCAGGAGAACGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195009054_1195009058 20 Left 1195009054 X:100717361-100717383 CCAGCAGTAGCACATGAACTGAT 0: 1
1: 0
2: 0
3: 3
4: 94
Right 1195009058 X:100717404-100717426 CTGGATAAGCAGGAGAACGAGGG 0: 1
1: 0
2: 0
3: 9
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195009058 Original CRISPR CTGGATAAGCAGGAGAACGA GGG Intronic
902838135 1:19059633-19059655 CTGGACACCCAGGAGAACCATGG + Intergenic
904609919 1:31720208-31720230 CTGGATAACGAGGAGGACCAAGG + Intergenic
904829342 1:33296623-33296645 TTGGATGAGGAGGAGAAAGAGGG + Intronic
906234906 1:44200369-44200391 CTGGAGATGAAGGAGAAAGAAGG - Intergenic
906608606 1:47187472-47187494 CTGCATGTGCAGGAGAGCGAGGG + Intronic
906669691 1:47645469-47645491 CTGGAGAGGCAAGAGAAGGATGG + Intergenic
907137976 1:52157288-52157310 TTGGATAAGCAGGAGGCTGAGGG - Intronic
912550071 1:110479718-110479740 CAGGATAAGAAGGAAAACAAAGG - Intergenic
913505765 1:119515092-119515114 CTGGAAAAGAAGGAGAAAGGAGG - Intergenic
914764683 1:150627573-150627595 CAGGACACGCAGGAGAAAGAAGG - Exonic
915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG + Intergenic
916702893 1:167316407-167316429 CTTGATAACTAGGAGAATGAGGG + Intronic
919784593 1:201251234-201251256 CAGCATCAGCAGGACAACGAAGG - Intergenic
923110284 1:230884771-230884793 CTGGCTAAGCAGAAGACCGGGGG - Intergenic
1063034889 10:2276653-2276675 CTGGAGAAGCAGGAGTATGGTGG - Intergenic
1063075381 10:2711340-2711362 CTGGATAAGTAGGTCAAGGAGGG - Intergenic
1063629555 10:7721193-7721215 CTGGTTAAGCAGGTGACTGACGG - Intronic
1066124448 10:32326411-32326433 CTGGATCAGCAGGGGAACCAGGG - Intronic
1067285487 10:44904744-44904766 CTGGAGGAGAAGGAGAAGGATGG + Intergenic
1070145557 10:73771309-73771331 CAGGATTAGCAGGAAAAAGAGGG - Exonic
1070706324 10:78641751-78641773 CTTGTGAAGCAGGAGAAAGATGG - Intergenic
1071913454 10:90262923-90262945 CTCTATAAGCACGAGAACCAAGG + Intergenic
1075611735 10:123860042-123860064 CTGGGCAAGCAGGAGAAACAAGG + Intronic
1075798278 10:125136155-125136177 CCAGATAAGGATGAGAACGAAGG + Intronic
1080122446 11:28693236-28693258 GTGGTAAAGCAGGAGAAAGAAGG - Intergenic
1081760077 11:45571037-45571059 CTGGATCACCAGGAGAACCCTGG + Intergenic
1082236980 11:49830428-49830450 CTAGATAAGCAGGAAACCTATGG - Intergenic
1082768723 11:57188931-57188953 CTGGATAAGCCCTAGAAGGAAGG + Exonic
1088145397 11:106670745-106670767 CTGGCTAAGCAGGACAAGGTTGG - Intergenic
1096273830 12:50188785-50188807 CTGGCCAAGCAGTTGAACGAGGG + Intronic
1096851675 12:54442898-54442920 CCGGAGAAGCAAGAGAATGAAGG + Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1099108696 12:78528918-78528940 TGAGATAAGCAGGAGAAAGAAGG - Intergenic
1099570301 12:84309221-84309243 CTGGGTAAGAAGGAGAATAATGG + Intergenic
1099998191 12:89802692-89802714 CTGGATAACCAGGAGAGGGATGG - Intergenic
1101071220 12:101077885-101077907 CCGGATAAGCAAAAGAAGGAGGG - Intronic
1104039996 12:125123485-125123507 CTGGGGAAGTAAGAGAACGAAGG + Intronic
1104299377 12:127550450-127550472 CTGGAAAAGCTGGAGAGCCACGG + Intergenic
1105313596 13:19236008-19236030 CTTGATAAGCACGAGAAGCATGG - Intergenic
1106485250 13:30166731-30166753 CTGGATGAGCAGGAGTAGGCGGG - Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1108297319 13:49037473-49037495 TTGGATAAGGAGGAGATAGAAGG + Intronic
1109233951 13:59792784-59792806 CTGAAAAAGTAGGAGAATGAAGG - Intronic
1111102772 13:83609565-83609587 CAGGATTAGCAGGAGTATGAGGG + Intergenic
1115734834 14:36314682-36314704 CTGGAAAAGCAGAAGTAAGAAGG - Exonic
1118727109 14:68636825-68636847 CTGGCAAAGCAGGAGGACGGCGG + Intronic
1120299917 14:82692979-82693001 CAGGACACGCAGGAGAAAGAAGG - Intergenic
1122780919 14:104143147-104143169 CTGGATAAGCAAGAGATGCACGG - Intronic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129776597 15:78241080-78241102 CAGGACGAGCAGGAGAACAATGG + Intronic
1131329209 15:91480661-91480683 CTGTGTAAGCAGGAGACAGAAGG + Intergenic
1134223724 16:12375635-12375657 CTGGATAGGCAAGAAACCGAGGG - Intronic
1134795117 16:17028042-17028064 CTGGATAAACAGAATAACTATGG - Intergenic
1135848252 16:25938911-25938933 CTGGTTTAGCAGGAGAAAGGGGG - Intronic
1137432227 16:48427657-48427679 CAGGATAGGCAGGAGAAACAAGG - Intronic
1137805557 16:51301882-51301904 CTGAAGAAGCAGCAGAAAGAAGG - Intergenic
1139228284 16:65254590-65254612 CAGGATGAGCTAGAGAACGAAGG - Intergenic
1140507302 16:75481892-75481914 CTGGTAAAGCAGGAGGGCGATGG + Intronic
1141336611 16:83161692-83161714 GTGGATAAGAAAGAGAACCATGG - Intronic
1141525909 16:84611652-84611674 ATGAATAAACAGGAGAATGAAGG + Intronic
1142911697 17:3098605-3098627 CTGGAGAAGCAGCAGCACGCTGG - Intergenic
1144078020 17:11736452-11736474 GTGGAGAAGCAGGTGAACTAGGG - Intronic
1145898246 17:28473370-28473392 CTGGAGGAGCTGGAGAAGGAAGG - Exonic
1146656298 17:34637154-34637176 CTGGAGGAGAAGGAGAAGGAGGG - Intronic
1148464775 17:47858213-47858235 CTGGGCAAGGAGGAGAAAGATGG - Intergenic
1149439630 17:56663670-56663692 CTGGATGCCCAGGAGAATGACGG + Intergenic
1151561434 17:74871993-74872015 CTGGAGCAGCAGGTGAATGATGG + Intronic
1156832960 18:41516872-41516894 CTGTATAAGCAGGAGAAGAATGG - Intergenic
1157517287 18:48320139-48320161 CTGGAGAAGAAGGAGAAGGAGGG + Intronic
1161842767 19:6692967-6692989 CTGGAGAAGCAGAAGCCCGACGG - Exonic
1163953666 19:20614077-20614099 CTGCAGAAGCAGGAGAACTCAGG + Intronic
1167792787 19:51691503-51691525 GAGGAAAAGCAGGAGAAAGAGGG + Intergenic
926591866 2:14749124-14749146 TTGGACAAGCAGGAGAAGGTTGG + Intergenic
933505830 2:83176129-83176151 TTGGATAAGGAGGAGGAAGAGGG - Intergenic
933606156 2:84386227-84386249 ATGGATAAGCTGTAGAAGGAAGG + Intergenic
937398969 2:121564926-121564948 TGGGATAAGCAGGAGAATGCAGG + Intronic
938570981 2:132561676-132561698 CTGGATACCCAGGAGAGCAAAGG + Intronic
939209216 2:139150749-139150771 CTGGAGAACCAGGAGATCCAAGG + Intergenic
940471356 2:154104524-154104546 CTGGAAAAGGAGGTGAAGGAGGG - Intronic
941650407 2:168086123-168086145 ATGGATGATCAGGATAACGATGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942487017 2:176450794-176450816 CAAGATAAGCAGAAGAACCATGG - Intergenic
942677969 2:178448800-178448822 CTGGACAAGAGGGAGAAAGACGG + Intronic
943477965 2:188382845-188382867 GTGGCTAAGCTGGAAAACGATGG + Intronic
944179629 2:196875188-196875210 CTGGATAAGCAGGACATCTGTGG + Intronic
944579981 2:201124080-201124102 CTAGAGAAGCAGTAGAAAGAAGG + Intronic
946185245 2:217977225-217977247 CTGGATAAACAGAACAAGGAGGG + Intronic
946648673 2:221868234-221868256 CTGGAAAAGCAGGAGATCCTGGG + Intergenic
946905055 2:224407673-224407695 CTGGGTGAGCAGCAGAACCAGGG - Intergenic
1169523799 20:6401309-6401331 CTGGAGAACCAGGAAAACAAAGG + Intergenic
1170596033 20:17806634-17806656 CAGGGTAAGGAGGAGAAAGAAGG + Intergenic
1171822667 20:29868392-29868414 ATGGAGAATCAGGAGAAAGAAGG + Intergenic
1172463124 20:35135043-35135065 CAGGATACCCAGGAGAAAGAGGG - Intronic
1173256833 20:41399743-41399765 CTGGAAAAACAGGATAAGGAAGG - Intergenic
1177989344 21:28019153-28019175 CTTGAACAGCAGGAGAAGGATGG - Intergenic
1178210638 21:30527417-30527439 CTGGATTAGGAGGAGAGCGGTGG - Intergenic
1178345936 21:31828044-31828066 CTGGACAAGATGGAGAAAGAGGG + Intergenic
1178820036 21:35966668-35966690 CTGGGGAAGCAGGAGTATGAGGG + Intronic
1179180780 21:39043069-39043091 CTGGAGACCCAGGAGAACAAAGG - Intergenic
1184872855 22:47251897-47251919 CAGGATAAGCAGGAGGCCTAGGG + Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
951261773 3:20518229-20518251 CTGGATAGGGAGGAGAGAGAGGG - Intergenic
952162128 3:30704518-30704540 CTGTATAAGAAAGAGAAAGATGG - Intergenic
952186575 3:30975853-30975875 CAGTGTAAGCAGGAGAACCAGGG - Intergenic
952783867 3:37132663-37132685 ATGGATAAGCAGGAGTAGCAAGG + Intronic
952863531 3:37834701-37834723 GTGGATAAGCAGGGGAACTGTGG - Intergenic
952875574 3:37941708-37941730 AGGGATAAGGAGGAGAAAGAGGG + Intronic
954553850 3:51503370-51503392 CGGGAGAAGGAGGAGAATGAAGG - Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
962396159 3:135016904-135016926 CCAGATAAGCAGGAGAACTCTGG - Intronic
963081136 3:141394637-141394659 CTGGATAGGCTGGTGAAGGAAGG - Intronic
973094145 4:46176328-46176350 TTGGCTAAGCAGGAGAGTGAGGG - Intergenic
973197170 4:47458713-47458735 CTGAAGAAGCATGAGAATGAAGG + Intronic
977525501 4:98141318-98141340 CTGGAAAGGAAGGAAAACGAAGG - Intronic
979032045 4:115661649-115661671 CTGGATAAACAGCAGAAGGAAGG - Intergenic
982502762 4:156178510-156178532 CTGGATAATCAGGAGAGCTTAGG + Intergenic
984510612 4:180674103-180674125 CAGGAGAAGCAGGTGAAAGATGG + Intergenic
986468506 5:8050689-8050711 CTGTATAAGAAGGAGAAGGAAGG + Intergenic
987046766 5:14116058-14116080 CTGGAGAACCAGGAGAGCCAGGG + Intergenic
988532202 5:32037670-32037692 TTCAATAAGCAGGAGAAAGATGG + Intronic
991964160 5:72074382-72074404 CTGAATAAGCAAGGGAAGGAAGG - Intergenic
992201011 5:74383977-74383999 GTGGATGAGGAGGAGAAGGAGGG + Intergenic
992363288 5:76064658-76064680 CCGGAGAAGAAGGAAAACGATGG - Intergenic
992386585 5:76290445-76290467 CTTGATTAGCAGGAGAAGGCGGG + Intronic
994387024 5:99144581-99144603 ATGGAGATGGAGGAGAACGATGG + Intergenic
995030736 5:107478169-107478191 CTGGATCAGGAGGAGAAGCAGGG - Intronic
996304841 5:122035281-122035303 CTGGACACTCAGGAGAAAGATGG - Intronic
996471919 5:123871260-123871282 TTGGAGAAGCTGGAGAAGGAAGG + Intergenic
997294678 5:132762096-132762118 CTGGAGAATCAGGAGCACCAGGG - Intronic
1000942741 5:167382479-167382501 GTGGATAAGCAGGATAGCCAAGG + Intronic
1002049896 5:176564785-176564807 ATGTATCAGCAGGTGAACGAAGG + Intronic
1006750212 6:36372305-36372327 CTGGAGCAGCAGGAGCACGGGGG + Intronic
1010364665 6:75035423-75035445 CTGGAAAAGCAGGAGAATGCTGG + Intergenic
1010806587 6:80244191-80244213 CTGGTGAAGCAGGAGATGGAAGG + Intronic
1013202531 6:107913653-107913675 CTGGTTAAGCTTGAGAACCATGG - Intronic
1015438934 6:133224960-133224982 AAGGATCAGCAGGAGAACCAAGG - Intergenic
1015681605 6:135814695-135814717 CTGGAAAGGCAGGACATCGAGGG + Intergenic
1017935335 6:159000066-159000088 CTGGAAGAGCAGGAGCACGTGGG - Exonic
1022793708 7:33714856-33714878 GAGGAGAAGCAGGAGAACAAGGG - Intergenic
1028907968 7:96175962-96175984 CTGGTTAAACAGGAAAATGAAGG + Intronic
1029947811 7:104551803-104551825 AGGGAGAAGCAGGAGAACGGAGG + Intronic
1031740748 7:125427242-125427264 CTGGAAAAGAAGGAGATCAATGG - Intergenic
1033019582 7:137709542-137709564 TTGGATAACCTAGAGAACGAAGG - Intronic
1033181454 7:139183355-139183377 CAGGAACAGCAGGAAAACGATGG + Intronic
1033195228 7:139321782-139321804 CTGGGGAAGCAGGGGAAGGAAGG - Intergenic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1034570856 7:151955247-151955269 CGGGATTAGCAGGAGATCGGTGG + Intergenic
1035827634 8:2661401-2661423 CTGGATTAGGAGGAGGACTAAGG + Intergenic
1044905570 8:96998020-96998042 CAGGATAAGCAGAAGAATAAAGG - Intronic
1045063950 8:98429027-98429049 ATTGAAAAGGAGGAGAACGAGGG + Exonic
1047011334 8:120675666-120675688 CTGGAAATGCAGGGGAACAAAGG + Intronic
1047403703 8:124567624-124567646 CTGGAAAAGCACAAGAAAGAAGG - Intronic
1050119361 9:2292520-2292542 CTGGCCTAGCAGGAGAACAAAGG + Intergenic
1053750017 9:41243742-41243764 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1054255516 9:62808080-62808102 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1054335789 9:63807528-63807550 ATGGAGAACCAGGAGAAAGAAGG + Intergenic
1055409615 9:76015100-76015122 CTGGAGAACCAGGAGAGCCAAGG + Intronic
1058989732 9:110243231-110243253 CTGAGTAAGCAGGAAAATGATGG - Intergenic
1059114099 9:111585373-111585395 AAGGATGAGCAGGATAACGAAGG + Intronic
1059502559 9:114767468-114767490 GTGGATAAGCAGGTGAGCTAAGG + Intergenic
1059786752 9:117594439-117594461 CTGTATCAGCAGGAGAAGAAAGG + Intergenic
1061227050 9:129286513-129286535 CTCAATAAACAGGAGATCGATGG - Intergenic
1061794792 9:133080081-133080103 CTGCAGGAGCAGGAGAACTAAGG - Intronic
1061878271 9:133555770-133555792 GTGGATTATGAGGAGAACGAGGG + Exonic
1062077146 9:134595572-134595594 CTGGAGAACCAGGAGCACCAAGG - Intergenic
1062156711 9:135053200-135053222 CTGGACAAGCTGGAGAAACACGG - Intergenic
1203375716 Un_KI270442v1:374937-374959 ATGGAGAACCAGGAGAAAGAAGG + Intergenic
1187558299 X:20374197-20374219 CTGGAAAGGCAGGAGTATGAAGG - Intergenic
1189901909 X:45715148-45715170 CTGAATAAGCAGGGGAACTTGGG - Intergenic
1195009058 X:100717404-100717426 CTGGATAAGCAGGAGAACGAGGG + Intronic
1196023188 X:111011664-111011686 CTGCAGAAGCAGAAGAACGGAGG - Intronic
1199833242 X:151563969-151563991 CAGGATGACCAGGAAAACGAGGG - Intronic
1200337944 X:155369833-155369855 GAGGAGAAGCAGGAGAAGGAGGG + Intergenic
1200348526 X:155471393-155471415 GAGGAGAAGCAGGAGAAGGAGGG - Intergenic
1201066313 Y:10098629-10098651 ATGGAGAACCAGGAGAAAGAAGG - Intergenic