ID: 1195010740

View in Genome Browser
Species Human (GRCh38)
Location X:100730766-100730788
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 533
Summary {0: 2, 1: 0, 2: 2, 3: 51, 4: 478}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195010740_1195010745 26 Left 1195010740 X:100730766-100730788 CCAAGTTGGTGGTGCTTTTCTAC 0: 2
1: 0
2: 2
3: 51
4: 478
Right 1195010745 X:100730815-100730837 AAACGCAGAAAACTTCATCAAGG 0: 1
1: 0
2: 1
3: 21
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195010740 Original CRISPR GTAGAAAAGCACCACCAACT TGG (reversed) Intronic
900016750 1:156326-156348 GTAGGAGATCACCACCAACCTGG - Intergenic
900047010 1:514918-514940 GTAGGAGATCACCACCAACCTGG - Intergenic
900069214 1:756633-756655 GTAGGAGATCACCACCAACCTGG - Intergenic
901332133 1:8418259-8418281 GTGTCAATGCACCACCAACTGGG + Intronic
902333050 1:15740024-15740046 GTAGCAAAGAACCACAGACTGGG + Exonic
904439448 1:30520891-30520913 GGAGAAAAGCAGCACGATCTTGG + Intergenic
907421087 1:54347912-54347934 GTAACAAAGTACCACAAACTAGG - Intronic
907582833 1:55587421-55587443 GTAACAAAGAACCACAAACTGGG + Intergenic
909157436 1:72096056-72096078 GAAGAAAAGTACTACAAACTGGG - Intronic
909704743 1:78568302-78568324 TTAACAAAGCACCACAAACTGGG - Intergenic
909954060 1:81755685-81755707 GTAGAATAGCAAAACCAGCTGGG - Intronic
910162183 1:84285246-84285268 GTAATAAAGTACCACAAACTGGG + Intergenic
910438460 1:87228883-87228905 GTAACAAATTACCACCAACTTGG - Intergenic
910802243 1:91158434-91158456 GTAGCAAACTACCACAAACTAGG + Intergenic
911365632 1:96934322-96934344 GTAAAAAATTACCACAAACTCGG + Intergenic
911573043 1:99540693-99540715 GTAAAAAAGTAACACAAACTGGG - Intergenic
911697138 1:100902503-100902525 GTAATAAAACACCACAAACTAGG + Intronic
912582293 1:110731395-110731417 GTAACAAAGTACCACAAACTGGG - Intergenic
915087830 1:153400075-153400097 TTAGAAAAGCACCACAGACTTGG + Intergenic
915756307 1:158263704-158263726 GTAGAAAGGAACCAGCAAGTAGG + Intergenic
916305920 1:163332427-163332449 GTAATAAATCACCACAAACTTGG + Intronic
916732515 1:167579391-167579413 GTAACAAAGCACCACAAACTGGG - Intergenic
917294860 1:173507886-173507908 GTAACAAAGTACCACAAACTGGG - Intronic
917608308 1:176659191-176659213 GTAACAAAGCCCCACAAACTGGG + Intronic
918595939 1:186293173-186293195 GTATAAAAGCACCACAGTCTAGG + Intergenic
918745406 1:188192760-188192782 GTAACAAAGTACCACAAACTTGG + Intergenic
919156121 1:193767817-193767839 GTAACAAAGTACCACAAACTGGG - Intergenic
919206077 1:194423063-194423085 CTAGAAAAGCACCAGAAACAGGG - Intergenic
919277918 1:195445047-195445069 GTAGAGAAGGACCATCAAGTGGG - Intergenic
920833642 1:209487774-209487796 ATAACAAAGTACCACCAACTGGG - Intergenic
920989775 1:210925768-210925790 GTAGAGAAAGACCACCAGCTTGG - Intronic
921498444 1:215869762-215869784 GTAGGAAAGAACCACAAACATGG - Intronic
921716459 1:218422042-218422064 GTAACAAAGTACCACAAACTGGG - Intronic
922078268 1:222269080-222269102 ATAGTAAAGCACCACAAACTGGG + Intergenic
922104578 1:222502028-222502050 GTAGGAGATCACCACCAACCTGG - Intergenic
922159040 1:223064798-223064820 ATAGAGAAGCACCACCCACCTGG - Intergenic
922259384 1:223923735-223923757 GTAATAAAGTACCACAAACTGGG - Intergenic
922264892 1:223974541-223974563 GTAGGAGATCACCACCAACCTGG - Intergenic
923267181 1:232326225-232326247 ATAACAAAGTACCACCAACTGGG + Intergenic
923307918 1:232705171-232705193 ATAGAAAAACACCAAAAACTTGG - Intergenic
924284890 1:242476011-242476033 GTAGCAAAATACCACCAACTGGG - Intronic
924340565 1:243026482-243026504 GTAATAAAGTACCACAAACTGGG - Intergenic
924346751 1:243079555-243079577 GTAGGAGATCACCACCAACCTGG - Intergenic
924421499 1:243914233-243914255 GTAACAAAGTACCACAAACTGGG - Intergenic
1063253698 10:4302986-4303008 ATAGCAAATTACCACCAACTGGG + Intergenic
1063468885 10:6268326-6268348 ATAGAAAAGCACCCCCAAAAAGG - Intergenic
1064314850 10:14245827-14245849 GTAATAAAGCACCACAGACTGGG - Intronic
1066589741 10:36981539-36981561 GTAACAAAGTACCACAAACTGGG - Intergenic
1066735936 10:38479117-38479139 GTAATAAAGTACCACAAACTGGG + Intergenic
1067554633 10:47260029-47260051 GTAAGACAGCACCACAAACTGGG + Intergenic
1068563541 10:58545119-58545141 GTAATGAAGTACCACCAACTAGG - Intronic
1068724335 10:60284330-60284352 ATAGTAAACCACCACAAACTGGG - Intronic
1070381770 10:75886902-75886924 GTAGAAAAGCACAAGAACCTAGG - Intronic
1070396702 10:76017445-76017467 GTTGCAAAGTACCACCAACTGGG - Intronic
1070410540 10:76135516-76135538 GTAACAAAGCACAACCAACTAGG + Intronic
1071093467 10:81946948-81946970 GTGACAAAGCACCACAAACTGGG + Intronic
1071262652 10:83934909-83934931 ATAGCAAAGCACCATAAACTGGG + Intergenic
1072021245 10:91404756-91404778 GTAGAACTGCAACACCAGCTTGG - Intergenic
1072649039 10:97279220-97279242 ATTAAAAAGCACCACCAGCTTGG - Intronic
1072675629 10:97463783-97463805 GTTGAACAGCACCACCCTCTGGG - Intronic
1073298531 10:102456294-102456316 GTAACAAATCACCACAAACTTGG - Intergenic
1073479337 10:103776502-103776524 GTAACAAAGTACCACAAACTAGG + Intronic
1073546889 10:104357010-104357032 ATAACAAAGCACCACAAACTGGG + Intronic
1073882690 10:108001831-108001853 GTAACAAAGTACCACAAACTTGG + Intergenic
1074266813 10:111912580-111912602 GTAACAAAGCACCACAAATTGGG - Intergenic
1075056554 10:119223006-119223028 GTAATAAAGTGCCACCAACTGGG + Intronic
1075235767 10:120727456-120727478 ATAGCAAAGTACCACAAACTGGG + Intergenic
1075686416 10:124367916-124367938 GGAGAAAAGCAGCACCCAGTGGG + Intergenic
1075957746 10:126538524-126538546 GTAGCAAAGCACCATGCACTTGG - Intronic
1076973340 11:151399-151421 GTAGGAGATCACCACCAACCTGG - Intergenic
1077882938 11:6365264-6365286 GTAAAAAATTACCACAAACTTGG - Intergenic
1078634243 11:13033991-13034013 GTAACAAAGCACCACAAATTGGG - Intergenic
1082098450 11:48151123-48151145 ATAAAAAAGCACCACAAACTGGG + Intronic
1082637554 11:55614992-55615014 ATAACAAAGCACCACAAACTGGG - Intergenic
1083064947 11:59914855-59914877 GTAACAAAGCACCACAAATTGGG + Intergenic
1083162394 11:60862770-60862792 TTAGAGAACCACCACCCACTTGG + Intergenic
1083473847 11:62902844-62902866 GTAACAAAGTACCACAAACTGGG - Intergenic
1084582986 11:70036066-70036088 GTAACAAACCACCATCAACTGGG + Intergenic
1086846718 11:91759079-91759101 ATAGAAAAGTACTACAAACTAGG - Intergenic
1086916507 11:92535423-92535445 GTAACCAAGCACCACAAACTGGG - Intronic
1086971802 11:93089528-93089550 GTAGCAAAGCGCCACAAACTGGG + Intergenic
1087615531 11:100482508-100482530 CTAGAAAACCACCAGAAACTAGG - Intergenic
1087688923 11:101297394-101297416 GTAGAAAAGAACCATCAGGTGGG + Intergenic
1088278855 11:108116935-108116957 GCAGCAAATTACCACCAACTGGG - Intergenic
1088768801 11:113012458-113012480 GTAGTAATGCACCACAAACCAGG + Intronic
1089166973 11:116484856-116484878 GTAAAAAAGTACCACAAATTGGG - Intergenic
1090032866 11:123222359-123222381 ATAGCAAAGTACCACAAACTAGG - Intergenic
1090172352 11:124616158-124616180 GAAACCAAGCACCACCAACTGGG + Intronic
1090681096 11:129058038-129058060 GTAGTAAAATACCACAAACTGGG - Intronic
1091824269 12:3498808-3498830 GTAATAAAGTACCACAAACTGGG + Intronic
1092048897 12:5454053-5454075 GTAACAAAGCACCACAAATTGGG + Intronic
1092481928 12:8867329-8867351 ATAGAAAATCACCATCAACAAGG - Intronic
1093149317 12:15602863-15602885 GTAACAAAGCACCATAAACTAGG + Intergenic
1093857271 12:24121015-24121037 AGAGAAAAACAGCACCAACTAGG + Intergenic
1093974873 12:25410587-25410609 GTAACAAAGTACCACAAACTGGG - Intronic
1094031783 12:26020393-26020415 GTAGCAAATTACCACAAACTGGG - Intronic
1094318685 12:29160581-29160603 GTAACAAAGTACCACAAACTGGG + Intronic
1094616828 12:32043465-32043487 ATAACAAAGCACCACAAACTGGG + Intergenic
1095658351 12:44697960-44697982 CTAGCAAAGCACCAGCAGCTAGG - Intronic
1095891447 12:47238293-47238315 GTAAAAAAACACCACAAACTTGG + Intergenic
1096261912 12:50098238-50098260 GTAGCAAACTACCACAAACTGGG + Intronic
1097102141 12:56597263-56597285 GAAGAAAAGCACAACTAAATGGG + Exonic
1098879965 12:75907098-75907120 ATAATAAAGCACCACTAACTGGG + Intergenic
1099450257 12:82799485-82799507 GTAGCAAAGTACCACAGACTGGG + Intronic
1100664690 12:96738333-96738355 GTAGCAAAGTACCAAAAACTGGG + Intronic
1100951283 12:99853106-99853128 GTAGAGAAACACCACCAGGTTGG - Intronic
1101002229 12:100368103-100368125 GTAACAAAGTACCACAAACTAGG + Intronic
1101003146 12:100376222-100376244 GTAACAAAGCACCACAAACTAGG - Intronic
1101395108 12:104340405-104340427 GTAACAAAGTACCACAAACTGGG + Intronic
1101511014 12:105392398-105392420 GTAACAAAGCACCACAAAATGGG - Intronic
1101692595 12:107095466-107095488 GTAAAAAAGCACCACAAATTGGG - Intergenic
1101749578 12:107572405-107572427 GTAGCAAAAGACCACAAACTTGG - Intronic
1102231655 12:111266727-111266749 GTAGAAAAGCACCACCAACTGGG - Intronic
1103011625 12:117462633-117462655 GCAGCAAACCACCACCCACTGGG - Exonic
1103797689 12:123516176-123516198 GTAGCAAAGCACCTTCAACATGG + Intronic
1104146549 12:126039612-126039634 TTAAAAATGCACCACAAACTGGG + Intergenic
1105839763 13:24243939-24243961 GTAACAAATCACCACAAACTAGG + Intronic
1105914810 13:24903601-24903623 GTAACAAAGTACCAGCAACTGGG - Intronic
1106577632 13:30990610-30990632 GTATCAAAGCACCACAAACTAGG + Intergenic
1106907078 13:34420421-34420443 GTCACAAAGCACCACAAACTGGG + Intergenic
1107317881 13:39153126-39153148 GTAAAAAATTACCACAAACTTGG - Intergenic
1107328146 13:39267411-39267433 ATAGCAAAGTACCACAAACTAGG - Intergenic
1108167094 13:47704876-47704898 GTAGCAAATTACCACCAACTTGG + Intergenic
1108505350 13:51107934-51107956 GTAACAAAGCACCACAAACTGGG + Intergenic
1108716266 13:53081102-53081124 GTAACAAAGCACCACAAACAGGG - Intergenic
1108843550 13:54651068-54651090 GTAGTAAAGTACCACAAACTGGG + Intergenic
1108883742 13:55154231-55154253 GTAACAAATCACCACAAACTTGG - Intergenic
1110321200 13:74161642-74161664 GTAACAAATCACCACAAACTCGG - Intergenic
1111077674 13:83259712-83259734 GTAGAAAAGCCCCATGAAATTGG + Intergenic
1111622947 13:90747548-90747570 GTAACAAAGTACCACAAACTGGG + Intergenic
1112364580 13:98745768-98745790 TAACAAAAGCACCACAAACTGGG - Intronic
1112635937 13:101218288-101218310 GTAAAAAAGCTCCACAAACCTGG + Intronic
1112665320 13:101565115-101565137 ATAACAAAGCACCACAAACTTGG - Intronic
1112865683 13:103894055-103894077 GTAACAAAGCACCACAAACTGGG + Intergenic
1113223691 13:108134952-108134974 GTAACAAAGTACCACAAACTGGG - Intergenic
1113260732 13:108559432-108559454 AAAGAAAAGCACCACAAACTGGG - Intergenic
1113613542 13:111664918-111664940 GTGGCAAAGCACCACACACTGGG - Intronic
1115788045 14:36848098-36848120 GGAGAAAAACACCACGAATTGGG + Intronic
1116870747 14:50067352-50067374 ATAGCAAAGCACCACAGACTGGG + Intergenic
1118075723 14:62296339-62296361 ATAAAAAAGTACCACAAACTGGG - Intergenic
1119331113 14:73794517-73794539 GTAACAAATTACCACCAACTTGG - Intergenic
1119456493 14:74760452-74760474 GTAACAAAGCACCACAAACTGGG + Intergenic
1119993337 14:79224955-79224977 GTAACAAAGAACCACAAACTGGG - Intronic
1120382632 14:83800707-83800729 ATAGAAAAGAACCACAGACTGGG + Intergenic
1120488472 14:85145848-85145870 TAACAAAACCACCACCAACTGGG - Intergenic
1120609354 14:86621450-86621472 GTAACAAAGCACCACAAATTGGG + Intergenic
1120721320 14:87892366-87892388 GCAACAAAGCACCACAAACTGGG - Intronic
1120970310 14:90201633-90201655 GCAACAAATCACCACCAACTTGG + Intergenic
1121567663 14:94922908-94922930 ATAACAAAGCACCACAAACTGGG + Intergenic
1121800384 14:96769470-96769492 GTCACAAAGCACCACAAACTGGG + Intergenic
1121918788 14:97860991-97861013 GTAATAAAGTACCACAAACTAGG - Intergenic
1123788275 15:23694030-23694052 GTAAAAAATCACCACAAATTGGG + Intergenic
1124546819 15:30636618-30636640 GTAGCAAAGTACTACAAACTAGG + Intronic
1124780424 15:32626614-32626636 GTAGCAAAGTACTACAAACTAGG + Intronic
1125269391 15:37921565-37921587 GTAGAAAAGGACCATCAGGTGGG + Intergenic
1125647908 15:41288324-41288346 GTAACAAAGCACCACAAATTGGG + Intergenic
1126340152 15:47631801-47631823 GTAAAAAATTACCACAAACTTGG - Intronic
1128232088 15:66042554-66042576 GTAAAAATCCACCACAAACTGGG + Intronic
1128810979 15:70572461-70572483 GTAACAAATCACCACGAACTTGG - Intergenic
1129061503 15:72864014-72864036 GTAAAAAAGTACCACAAACTGGG - Intergenic
1129640245 15:77369414-77369436 TTAGAAAACCAAGACCAACTTGG - Intronic
1130823947 15:87524630-87524652 GTAATAAAGTACCACAAACTGGG - Intergenic
1131079882 15:89526015-89526037 GTAACAAATCACCACAAACTCGG - Intergenic
1131997522 15:98146361-98146383 GTAAAAAATTACCACGAACTTGG - Intergenic
1132774145 16:1582539-1582561 GTAGCAAAGGACCACAAACTTGG - Intronic
1134449958 16:14357342-14357364 GTAAAAAATCACCACAAACAGGG - Intergenic
1136337305 16:29618518-29618540 GTAACAAAGTACCACAAACTTGG - Intergenic
1137924903 16:52531281-52531303 ATAGATCAGCACCACAAACTAGG - Intronic
1138192066 16:55021838-55021860 GTAGAGAAAGACCACCAGCTGGG - Intergenic
1138211646 16:55168001-55168023 GTAATAACTCACCACCAACTGGG - Intergenic
1138247057 16:55475546-55475568 GTAAAAAAGCACTACAGACTGGG + Intronic
1138646668 16:58430577-58430599 GTAACAAAACACCACAAACTAGG + Intergenic
1138850313 16:60621289-60621311 GTAACAAATCACCACAAACTTGG + Intergenic
1138853860 16:60663536-60663558 GTTAAAAAGCTCCACAAACTGGG - Intergenic
1139418451 16:66832866-66832888 GTAACAAAGAACCACAAACTGGG + Intronic
1140752450 16:78037925-78037947 GTAGAATAGCACCACCAGCCTGG + Intronic
1140764166 16:78140390-78140412 GTAGCAAAGTACCATAAACTGGG + Intronic
1140764542 16:78145031-78145053 GTAACAAAGCACCACAAATTGGG + Intronic
1140837204 16:78806177-78806199 GTAGAAAAACACCAAGAATTTGG - Intronic
1141225702 16:82113145-82113167 GTAATAAAGCACCACAGACTTGG + Intergenic
1141512681 16:84522885-84522907 GTAACAAAGTATCACCAACTGGG + Intronic
1141650689 16:85391369-85391391 GTAACAAAGTACCACAAACTGGG + Intergenic
1142446910 16:90146131-90146153 GTAGGAGATCACCACCAACCTGG + Intergenic
1142460580 17:89194-89216 GTAGGAGATCACCACCAACCTGG - Intergenic
1144045281 17:11449650-11449672 GTACAAAAGCACCACAAACTTGG + Intronic
1148390036 17:47265305-47265327 GTAACAAAGCACCACAAACTGGG + Intronic
1148481674 17:47963608-47963630 GTAACAAATCACCACAAACTGGG - Intergenic
1148957210 17:51363737-51363759 ATAGCAAAGCACCACAAACTGGG + Intergenic
1148969260 17:51464976-51464998 ATAGCAAAGTACCACAAACTAGG - Intergenic
1149881486 17:60296602-60296624 ATAACAAAGCACCACAAACTGGG - Intronic
1150165024 17:62933144-62933166 GTAACAAGGCACCACAAACTGGG - Intergenic
1150889061 17:69123788-69123810 GTAGAAAAGGACACCCAACAAGG + Intronic
1151160344 17:72159693-72159715 GTTGAAAAACAACAACAACTGGG + Intergenic
1151292903 17:73163347-73163369 GTAGAACAGCAGCATCATCTCGG + Intergenic
1151742240 17:75991549-75991571 GTGGAAGGGCTCCACCAACTTGG - Exonic
1152009355 17:77701603-77701625 GTAACAAAGCATCACAAACTGGG + Intergenic
1152478027 17:80531085-80531107 GTAACAAAGTACCACAAACTGGG - Intergenic
1153141184 18:1974040-1974062 GTAGAAAATTACCATAAACTTGG - Intergenic
1153642122 18:7166200-7166222 GTAACAAAGCACCACCAGCTGGG - Intergenic
1154438864 18:14369335-14369357 GTAACAAAGTACCACAAACTGGG + Intergenic
1156088077 18:33432240-33432262 GTAGAAAGGCACCACAGAATTGG + Intronic
1157056525 18:44235458-44235480 GTAAAAAATTACCACAAACTTGG + Intergenic
1157537165 18:48468387-48468409 GTAACAAAGCACCACAAACTGGG - Intergenic
1157755070 18:50210432-50210454 ATAGCAAAGAACCACAAACTGGG + Intergenic
1158403378 18:57140733-57140755 GTAGCAAAGTACCACAGACTGGG - Intergenic
1158827115 18:61235143-61235165 GTAACAAAGTACCACAAACTGGG + Intergenic
1158943184 18:62425156-62425178 ACAGCAAAGCACCACAAACTGGG - Intergenic
1160650296 19:221700-221722 GTAGGAGATCACCACCAACCTGG - Intergenic
1161228597 19:3160648-3160670 GTAACAAAGTACCACAAACTGGG + Intronic
1161308793 19:3582324-3582346 GTAACAAAGCACCAAAAACTGGG - Intergenic
1162475030 19:10894674-10894696 GAAGAAAAGCAGCAGCAGCTCGG - Intronic
1164082751 19:21874892-21874914 GCAAAAGAGCAACACCAACTTGG - Intergenic
1164190721 19:22914936-22914958 GCAAAAGAGCAACACCAACTTGG - Intergenic
1167509029 19:49886431-49886453 ATAGAAAAGCATCACCTCCTAGG + Intronic
925465439 2:4104213-4104235 GTAGCAAAATACCACCAGCTGGG + Intergenic
925980538 2:9173564-9173586 GTAAAAAAGTACCAAAAACTGGG + Intergenic
926590875 2:14738998-14739020 GTAACAAAGTACCACAAACTCGG - Intergenic
926942727 2:18155161-18155183 GTAACAAAGTACCACAAACTTGG - Intronic
927943683 2:27121849-27121871 GTAAGAAAGCACTACAAACTGGG - Intergenic
929007372 2:37409370-37409392 GTAACAAAGTACCACCCACTGGG + Intergenic
929047086 2:37800652-37800674 GTAGTAAATTACCACAAACTTGG + Intergenic
929224514 2:39499435-39499457 GTAACAAATCACCACAAACTTGG + Intergenic
929862549 2:45692199-45692221 ATAACAAAGCACCACAAACTGGG + Intronic
932297590 2:70640015-70640037 GTAACAGAGCACCACAAACTGGG + Intronic
932735558 2:74251894-74251916 GTAACAAAGTACCACAAACTAGG - Intronic
935268693 2:101415458-101415480 GTAGTAAAATGCCACCAACTAGG - Intronic
935285540 2:101560961-101560983 GTAACAAAGCATCACAAACTGGG - Intergenic
935398488 2:102636196-102636218 GAAGACAAAGACCACCAACTTGG + Intronic
935580665 2:104753533-104753555 GTAGAAAGACACCAGCAACAGGG - Intergenic
935599227 2:104905527-104905549 GTAACAAATCACCACAAACTGGG + Intergenic
936670330 2:114648982-114649004 GTGGAAAAGCACAACTAACGTGG + Intronic
937231436 2:120400314-120400336 GAAGAAAAGCAGCTCCATCTGGG - Intergenic
937561577 2:123231140-123231162 GTAGCAAAGGACCATCAGCTGGG + Intergenic
937767608 2:125680093-125680115 GTAGGAAAGAACCATCAAGTTGG + Intergenic
938564225 2:132503698-132503720 GTAGAGAAAGACCACCAGCTGGG + Intronic
938820518 2:134953836-134953858 GTAGAACAGCAGCACAAACAAGG + Exonic
938866142 2:135422881-135422903 GTAAAAAAGTACCACAAAGTGGG + Intronic
938954626 2:136286390-136286412 GTAACAAAGCACCACAGACTAGG + Intergenic
939585030 2:143993750-143993772 GTAACAAATTACCACCAACTTGG - Intronic
939794772 2:146629371-146629393 GTAACAAAGCACCATAAACTAGG + Intergenic
940259076 2:151761718-151761740 GTAACAAAGTACCACCAACTGGG - Intergenic
940275236 2:151933088-151933110 ATAACAAAGTACCACCAACTGGG - Intronic
940861400 2:158773904-158773926 GTAATAAAGTACCACAAACTGGG - Intergenic
940891768 2:159042337-159042359 GTTCAAACACACCACCAACTAGG - Intronic
941114182 2:161452541-161452563 GTAATAAATCACCACAAACTTGG + Intronic
941201729 2:162519949-162519971 GTAGAAAAAAACCATCCACTGGG - Intronic
941992781 2:171573222-171573244 GTAGCAAACAACCACAAACTGGG - Intergenic
944872468 2:203928048-203928070 TTAAAAAAACACCACCAACAAGG + Intergenic
944922959 2:204434577-204434599 GTAACAAATCACCACAAACTGGG - Intergenic
945060865 2:205907689-205907711 TTAAAAAATCACCACAAACTTGG + Intergenic
947078218 2:226367096-226367118 GTAACAAAGCACCACAGACTGGG - Intergenic
947324912 2:228963491-228963513 GTAACAAAGCACTACAAACTGGG - Intronic
947803271 2:232945725-232945747 GGAACAAAGCACCACAAACTGGG - Intronic
947985471 2:234444067-234444089 GTAACAAATCACCATCAACTTGG - Intergenic
948025370 2:234772163-234772185 GTAACAAATCACCGCCAACTGGG - Intergenic
949084851 2:242143838-242143860 GTAATAAAGTACCACAAACTGGG + Intergenic
1169523474 20:6398209-6398231 ATAGAAAAGCACCACTCACACGG - Intergenic
1170245753 20:14220130-14220152 GTAGGAAAGGACCATCAGCTGGG + Intronic
1170277246 20:14605161-14605183 GTAACAAAGTACCACAAACTAGG + Intronic
1170642335 20:18165595-18165617 GGAACAAAGCACCACAAACTGGG - Intronic
1170971605 20:21122186-21122208 GTAAGAAAGCTCCACAAACTAGG - Intergenic
1173400970 20:42725622-42725644 GTAGCAAAGTTCCACAAACTTGG + Intronic
1173749125 20:45462608-45462630 GTAACAAAATACCACCAACTGGG - Intergenic
1174459939 20:50675291-50675313 GTAATGAAGCACCTCCAACTAGG - Intronic
1175671908 20:60910572-60910594 GTAGCAAAGTACCACAGACTGGG + Intergenic
1176456818 21:6920097-6920119 GTAACAAAGTACCACAAACTGGG - Intergenic
1176834991 21:13785157-13785179 GTAACAAAGTACCACAAACTGGG - Intergenic
1176943184 21:14948630-14948652 GTAAAAAATCACCATAAACTTGG + Intergenic
1176985953 21:15436389-15436411 GTAAGAAAGCATCACAAACTTGG - Intergenic
1178757266 21:35363619-35363641 GTAACAAAGCACCACAAACTGGG - Intronic
1178898324 21:36578952-36578974 ATAACAAAGTACCACCAACTGGG + Intergenic
1178911038 21:36673949-36673971 GTAACAAATCACCACAAACTGGG - Intergenic
1179513759 21:41892404-41892426 GTATCAAAGTACCACAAACTGGG - Intronic
1182046337 22:27277143-27277165 GTAGAAACTTACCACTAACTAGG - Intergenic
1182234457 22:28864578-28864600 GTAGCAAATTACCACAAACTTGG - Intergenic
1182626424 22:31650059-31650081 GTAACAAAGCAACACAAACTGGG - Intronic
1184028227 22:41874126-41874148 ATAAAAAAGCACCTCTAACTCGG - Intronic
1184845431 22:47081307-47081329 GTAGAAACGCTCCATAAACTAGG + Intronic
1184989944 22:48160684-48160706 GTAACAAAACACCACAAACTGGG + Intergenic
949233233 3:1776240-1776262 GTAATAAATTACCACCAACTTGG + Intergenic
949285055 3:2392820-2392842 GTAACAAAGTACCACAAACTGGG + Intronic
949625851 3:5866093-5866115 GCAGAAAAGAAAAACCAACTAGG - Intergenic
952017572 3:28976389-28976411 ATAGCAAAGCACCACAGACTCGG + Intergenic
952928049 3:38336295-38336317 TTTGAAAAGTACCACCAACTAGG + Intergenic
952941179 3:38445419-38445441 CTAGAAAAGCACCAGAAACAGGG + Intergenic
953065335 3:39464579-39464601 GAAGTAAAGTACCACCAACTGGG + Intergenic
954570893 3:51639930-51639952 GTGGAAAAGCAGTACCATCTTGG - Exonic
956752386 3:72353647-72353669 GTAACAAAGTACCACAAACTGGG - Intergenic
959025359 3:101234472-101234494 GTAACAAAGTACCACAAACTAGG - Intronic
959530085 3:107425782-107425804 GTAAAAAAGCAAAACCAGCTAGG + Intergenic
960235480 3:115277159-115277181 GTAACAAAGTACCACAAACTGGG + Intergenic
960851558 3:122060038-122060060 GTAACAAAGTACCACAAACTGGG - Intronic
960895836 3:122504162-122504184 GTAACAAAACACCATCAACTGGG + Intronic
961550887 3:127670070-127670092 CCAGAAAAGCACCACCACCAGGG - Intronic
962185617 3:133256189-133256211 ATAGAAAACAACCAGCAACTTGG + Intronic
962234740 3:133698372-133698394 GTAGCAAAGTACCATGAACTGGG + Intergenic
963182641 3:142375170-142375192 GTAACAAAGTACCACGAACTGGG - Intronic
963906481 3:150777908-150777930 GTAAAAAAGTACCACAAAATGGG + Intergenic
964621042 3:158720418-158720440 GTAACAAAGTACCACAAACTAGG + Intronic
965065880 3:163848411-163848433 GTAACAAAGTGCCACCAACTAGG + Intergenic
965458693 3:168933766-168933788 ATAGCAAAGTACCACAAACTGGG + Intergenic
965898732 3:173612727-173612749 GTAACAAAGTACCACAAACTGGG + Intronic
965903185 3:173669289-173669311 GTAACAAAGTACCACAAACTGGG + Intronic
966553407 3:181230613-181230635 GTAGAGAAAGACCACCAGCTGGG + Intergenic
966587055 3:181638097-181638119 GTAATAAAGTACCACAAACTGGG + Intergenic
967550477 3:190789040-190789062 TTAACAAAGCACCACAAACTTGG + Intergenic
968281466 3:197480113-197480135 GTAACAAAGTACCACGAACTAGG + Intergenic
968367550 3:198198429-198198451 GTAGGAGATCACCACCAACCTGG + Intergenic
968624454 4:1620534-1620556 CTACAAAAGCACCACCACATAGG + Intronic
969421290 4:7098003-7098025 GTAACAAAGTACCACCAACTGGG - Intergenic
969704805 4:8785913-8785935 AAAGCAAAGGACCACCAACTGGG - Intergenic
971185733 4:24374211-24374233 GAAGAAAAGAAATACCAACTTGG - Intergenic
971355449 4:25890929-25890951 GGAGAAAAGCACCACTCACTTGG + Intronic
972974029 4:44611549-44611571 GAAGAAAAGCACCAAAAAGTTGG + Intergenic
973144912 4:46813089-46813111 GGAAGAATGCACCACCAACTGGG + Intronic
974422246 4:61692277-61692299 GTAGAAAAGAATTGCCAACTTGG - Intronic
975047773 4:69825889-69825911 CTAGAAAAGCACCAGAAACAGGG - Intronic
975826531 4:78325673-78325695 GAAGGAAAGCATCATCAACTAGG + Intronic
976204027 4:82607521-82607543 TTAGCAAAGAACCACAAACTGGG - Intergenic
977399879 4:96519437-96519459 GTAACAAAGAACCACAAACTAGG - Intergenic
977635558 4:99293854-99293876 GTAGAGAAAGACCATCAACTAGG - Intergenic
977860524 4:101953905-101953927 GTAGCAAATTACCACAAACTGGG + Intronic
978192819 4:105934973-105934995 GTAGAAGAGCTGCCCCAACTGGG + Intronic
978198553 4:105998190-105998212 GTGGAAAATCACCACTCACTGGG + Intronic
978689995 4:111496773-111496795 ATAGCAAAGTACTACCAACTCGG + Intergenic
978827693 4:113044503-113044525 ATAGCAAAGCACTACAAACTGGG + Intronic
979091906 4:116493770-116493792 GTGGAAAAGCATAACCAAGTTGG + Intergenic
979255962 4:118608135-118608157 GTAGGAGATCACCACCAACCTGG + Intergenic
979262285 4:118662079-118662101 GTAATAAAGTACCACAAACTGGG + Intergenic
979312405 4:119219180-119219202 GTAACAAAGAACCACAAACTGGG + Intronic
979332381 4:119432405-119432427 GTAGGAGATCACCACCAACCTGG - Intergenic
979504323 4:121478605-121478627 GTAACAAAGCACCACAAACTAGG - Intergenic
980264286 4:130495000-130495022 CTAGAAAAGCACCACAAGCCAGG + Intergenic
980892599 4:138831200-138831222 GTAAAAAATCACCACGAACTTGG - Intergenic
981218680 4:142204907-142204929 ATAACAAAGCACCACAAACTGGG - Intronic
981281835 4:142967310-142967332 GAAACAAAGCACCACAAACTGGG - Intergenic
981636734 4:146890111-146890133 ATAAAAAAGCAGCACAAACTGGG + Intronic
982213767 4:153062811-153062833 ATAACAAAGCACCACAAACTAGG - Intergenic
982877064 4:160663319-160663341 CTAGAAAAGCACCAGAAACAGGG - Intergenic
983082558 4:163404797-163404819 GTAGCAAAATACCACAAACTGGG - Intergenic
983149548 4:164261248-164261270 GTAATAAAGTACCACAAACTGGG - Intronic
983246133 4:165289729-165289751 TTAAAAAATCACCACCAAGTTGG + Intronic
983954264 4:173678346-173678368 ATAGCAAAGCACCACAGACTGGG - Intergenic
986163982 5:5257664-5257686 GTGGAAAAACCCCACCAATTTGG - Intronic
986367111 5:7043461-7043483 GTCACAAAGCACCACAAACTTGG + Intergenic
986459122 5:7951966-7951988 GTAGAAAATTACCACAAACCTGG - Intergenic
986574286 5:9196501-9196523 GTAAGAAAACACCACCGACTGGG - Intronic
986799708 5:11246612-11246634 ATAGCAAAGCACCACCAACTGGG - Intronic
986990694 5:13549532-13549554 GTAACAAAGTACCACAAACTGGG + Intergenic
987005988 5:13709852-13709874 GTAGGGAAGGACCACCAAGTAGG - Intronic
987263796 5:16230044-16230066 GTAACAAAGCACCACAAACTGGG - Intergenic
987268585 5:16281166-16281188 GTAACAAAGAACCACAAACTGGG + Intergenic
988713424 5:33801240-33801262 GTAACAAATTACCACCAACTTGG - Intronic
989073168 5:37533604-37533626 GTAGAGAAAAACCACCAGCTTGG + Intronic
989242391 5:39216178-39216200 GTAACAAAGTACCACAAACTAGG - Intronic
989355451 5:40539267-40539289 GTAGAAAAAGACCACCAGGTTGG + Intergenic
990079530 5:51896568-51896590 GTAACAAAGCACTACAAACTGGG + Intergenic
990352884 5:54936608-54936630 GTAACAAAGCACCACAGACTGGG + Intergenic
990440660 5:55841797-55841819 GTAGCAAATTACCACAAACTTGG + Intergenic
990686636 5:58310238-58310260 GTAACAAATTACCACCAACTTGG + Intergenic
990909605 5:60840563-60840585 ATAACAAAGTACCACCAACTGGG - Intronic
990980367 5:61597581-61597603 GTAACAAAGCACCACAGACTGGG + Intergenic
991084981 5:62640481-62640503 ATAACAAAGCACCACAAACTGGG + Intergenic
991152168 5:63383141-63383163 ATAACAAAGCACCACAAACTGGG - Intergenic
991446651 5:66707415-66707437 GTAACAAAGTACCACCAACAAGG + Intronic
991714978 5:69443122-69443144 ATAGAAAAGCAATACCAGCTGGG - Intronic
992037096 5:72790771-72790793 ATAGAAAAATACCACAAACTGGG + Intergenic
992083893 5:73260700-73260722 GTAACAAAGCACCACAACCTGGG - Intergenic
992464235 5:76987989-76988011 GCAACAAAGCACCACAAACTGGG - Intergenic
992545527 5:77810983-77811005 CTAGTAAAGCACCAGAAACTGGG - Intronic
992908385 5:81370761-81370783 GTAACAAAGCACCACAGACTGGG - Intronic
993331940 5:86611766-86611788 GTAGAAAAGCACCATAAATGTGG + Intergenic
995469996 5:112491181-112491203 GTAACAAATTACCACCAACTGGG - Intergenic
997181093 5:131829952-131829974 GTAACAAAGAACCACAAACTAGG - Intronic
997423860 5:133789627-133789649 GTAACAAAGTACCACCGACTGGG + Intergenic
997821730 5:137071940-137071962 GTAACAAAGCGCCACTAACTGGG - Intronic
998655748 5:144177383-144177405 GTAACAAAGTACCACAAACTGGG + Intronic
999155245 5:149453248-149453270 GTAGCAAATCACCTCCAACTGGG - Intergenic
999435424 5:151559689-151559711 GTAGAAAAGAAAAACCAAATGGG - Intronic
1000817988 5:165947652-165947674 CTAACAAAGCACCACAAACTTGG - Intergenic
1000865132 5:166504351-166504373 GTAACAAAGTACCACAAACTGGG + Intergenic
1001191989 5:169639870-169639892 GTAGCAAAATACCACCAACTGGG + Intronic
1002077838 5:176719806-176719828 GTAATAAAGCACCATCAGCTAGG + Intergenic
1002458755 5:179361944-179361966 GTAACAAATCAACACCAACTTGG + Intergenic
1002726774 5:181303656-181303678 GTAGGAGATCACCACCAACCTGG + Intergenic
1003237939 6:4315523-4315545 AAAGAAAAGAACCACTAACTGGG - Intergenic
1003450893 6:6230482-6230504 GTAGGAAAGGACCATCAACTGGG - Intronic
1004233790 6:13855342-13855364 GTAACAAAGTACCACAAACTGGG + Intergenic
1004323557 6:14652582-14652604 GTAGCAAATCAACACAAACTAGG - Intergenic
1004476880 6:15981560-15981582 ATAGCAAAGTACCACAAACTGGG + Intergenic
1004489446 6:16100318-16100340 ATAGCAAAGCACTACAAACTGGG + Intergenic
1004888546 6:20074931-20074953 GTAGAAAAAGGCCACCAGCTTGG - Intergenic
1004975983 6:20966956-20966978 GTAACAAAGTACCACAAACTGGG + Intronic
1005087504 6:22022056-22022078 GTAGCAAATTACCACAAACTTGG + Intergenic
1005353318 6:24958735-24958757 GTAACAAAGTACCACAAACTGGG + Intronic
1005477809 6:26225450-26225472 CTCGAAAAGCCCCACCAAGTAGG - Exonic
1007270512 6:40632676-40632698 GTACCAAAGCATCACAAACTGGG - Intergenic
1009267112 6:61569281-61569303 GTAGAAAAACACCATCAGCTGGG - Intergenic
1009467125 6:63985425-63985447 ATAGCAAAGTACCACAAACTGGG - Intronic
1009545755 6:65018180-65018202 ATATCAAAGCACCACAAACTGGG + Intronic
1010302395 6:74276849-74276871 GTAGAAAAGTAACAGCAAGTTGG + Intergenic
1010551752 6:77231930-77231952 AGAGAAAGGCAGCACCAACTTGG - Intergenic
1010687153 6:78866687-78866709 GTAGCAAAGCACGTCCAACATGG - Intergenic
1010889624 6:81290622-81290644 GAAAAAAAGAACTACCAACTGGG - Intergenic
1011788023 6:90868040-90868062 GTAACAAAGTACCACAAACTGGG - Intergenic
1011936445 6:92784524-92784546 GTAACAAATCACCACAAACTAGG - Intergenic
1012244448 6:96911089-96911111 GTAACAAAGTACCACAAACTGGG + Intergenic
1012262578 6:97104825-97104847 ATCGAAAAGCACCAGAAACTAGG - Intronic
1013186012 6:107758836-107758858 GTAACAAAGAACTACCAACTGGG - Intronic
1013580253 6:111527008-111527030 GTAACAAAGTACCACAAACTGGG + Intergenic
1014254814 6:119150388-119150410 ATAACAAAGCACCACCAACTGGG - Intergenic
1014736620 6:125101514-125101536 GTAGCAAAATACCACAAACTGGG + Intergenic
1015403311 6:132811253-132811275 ATAGCAAAGTACCACAAACTGGG - Intergenic
1015640969 6:135331921-135331943 GTAGCAAACTACCACAAACTTGG - Intronic
1016529429 6:145041624-145041646 GTAAAAAATTACCACAAACTGGG + Intergenic
1016879245 6:148894643-148894665 GTAACAAAGTACCACAAACTTGG - Intronic
1016989633 6:149920300-149920322 GTAGATGAGCACCACCACCAGGG - Intronic
1017019129 6:150126226-150126248 ATAGCAAAGCACCACTAACTGGG - Intergenic
1017197646 6:151718966-151718988 GAAGAAAAGCACCCCTATCTTGG + Intronic
1018674338 6:166206060-166206082 GTTGTAAAGCATCACAAACTGGG + Intergenic
1020101469 7:5396641-5396663 GCAGCAAAGCACCTCCAGCTGGG + Intronic
1020468965 7:8513823-8513845 GTAAAAAAGTAGCACAAACTTGG + Intronic
1020760908 7:12267781-12267803 GTATAAAAGGACCATAAACTAGG - Intergenic
1022232095 7:28423925-28423947 GTAGCAAAGTAGCACAAACTCGG + Intronic
1022304104 7:29130092-29130114 GTAACAAAACACCACCATCTGGG - Intronic
1022357519 7:29629929-29629951 GTAAGAAAGTACCACAAACTGGG + Intergenic
1022367831 7:29742893-29742915 GTAAGAAAGTACCACAAACTGGG + Intergenic
1022407005 7:30099867-30099889 ATAGCAAATCACCACCAACCAGG + Intronic
1024071664 7:45791282-45791304 GTAGGAGATCACCACCAACCTGG + Intergenic
1024360215 7:48460250-48460272 ATAGCAAAGAACCACAAACTGGG + Intronic
1027482641 7:78718115-78718137 GTAGAAAAGCAATGGCAACTAGG + Intronic
1028940214 7:96513348-96513370 GTAAGAAAGTACCACAAACTGGG - Intronic
1029007906 7:97229855-97229877 GTAACTAAGTACCACCAACTGGG + Intergenic
1029159713 7:98542996-98543018 GTAACAAAGTACCACAAACTGGG + Intergenic
1029295547 7:99537489-99537511 GTAACAAAGTACCACAAACTGGG - Intergenic
1029987622 7:104936428-104936450 TTACCAAAGCACCACAAACTAGG - Intergenic
1030755878 7:113287272-113287294 GTAACAAAGTACCACAAACTGGG + Intergenic
1030757479 7:113305822-113305844 ATAGACAATCACCACCAGCTTGG - Intergenic
1031281340 7:119804693-119804715 GTAACAAAGTACCACCAACTGGG + Intergenic
1032048286 7:128628862-128628884 GTAGGAGATCACCACCAACCTGG + Intergenic
1033247277 7:139728317-139728339 GTACCAAAGCACCACTGACTGGG + Intronic
1033592059 7:142817404-142817426 GTAATAAAGTACCACAAACTGGG + Intergenic
1034476504 7:151287362-151287384 GTAACAAATCACCACAAACTGGG - Intergenic
1034954491 7:155326215-155326237 GTAACAAAACACCACCACCTGGG + Intergenic
1036013777 8:4758136-4758158 GCAGAAAAACACCACCATTTTGG - Intronic
1036461108 8:8953705-8953727 ATAGAAAATGACCACAAACTGGG + Intergenic
1036693293 8:10958422-10958444 GGAGAATGGCAGCACCAACTGGG - Intronic
1037755700 8:21708897-21708919 GTAGCAAAGTACCACAAGCTGGG - Intronic
1040634510 8:49256455-49256477 ATAGCAAAGAACCACCGACTGGG + Intergenic
1040681345 8:49813427-49813449 GTAACAAAGTACCACAAACTAGG - Intergenic
1042356554 8:67834847-67834869 GTAACAAAGTACCACAAACTGGG + Intergenic
1042458385 8:69032262-69032284 CTAGAAAACCACCAGAAACTAGG - Intergenic
1042862598 8:73329194-73329216 GTACCAAAGCATCACCAACTGGG - Intergenic
1043256830 8:78148740-78148762 CTAGAAAAGCACCAGAAACAGGG - Intergenic
1043312920 8:78885324-78885346 GTAACAAAGTACCACAAACTAGG + Intergenic
1044279497 8:90339322-90339344 GTAATAAAGTACCACAAACTGGG + Intergenic
1045036851 8:98182506-98182528 GTAGTAAAGTACCATCAACTGGG + Intergenic
1045508564 8:102795544-102795566 GAAAAAAAGAACCAGCAACTGGG - Intergenic
1047221728 8:122924108-122924130 GTAACAAAGCACCACAAACTGGG + Intronic
1047361886 8:124176627-124176649 GTAACAAAGTACCACCAACTGGG - Intergenic
1047434610 8:124825789-124825811 ATAAGAAAGCACCACCAACTGGG + Intergenic
1048542825 8:135358279-135358301 GTAACAAAGCACTACAAACTGGG - Intergenic
1048937905 8:139372175-139372197 GTGAAAAATCACCACGAACTTGG + Intergenic
1049134517 8:140883803-140883825 GTAATAAATCACCACAAACTTGG + Intronic
1050063437 9:1734099-1734121 GAGGAAAGCCACCACCAACTGGG + Intergenic
1050204624 9:3183553-3183575 GTAACAAATCACCACAAACTTGG + Intergenic
1050715154 9:8515835-8515857 GTAAAAAAGAACCACATACTAGG - Intronic
1051088658 9:13380985-13381007 ATAGAAAAGTACTACAAACTGGG - Intergenic
1051589127 9:18758373-18758395 GTAAAAAATTACCACAAACTTGG + Intronic
1051745643 9:20292541-20292563 GTAACAAAGTACCACAAACTGGG + Intergenic
1052479375 9:29003235-29003257 GTAACAAAGTACCACAAACTCGG - Intergenic
1054707558 9:68478481-68478503 ATAACAAATCACCACCAACTGGG + Intronic
1054780013 9:69157365-69157387 GTAACAAAGCACCATAAACTGGG + Intronic
1055887482 9:81081085-81081107 ATAGCAAAGTACCACAAACTGGG + Intergenic
1056369830 9:85942225-85942247 GGAGAAAAGCAATACAAACTGGG + Exonic
1057052509 9:91936246-91936268 GTAACTAAGCACCACAAACTGGG + Intronic
1058422388 9:104844279-104844301 GTAGAGAAGCTGGACCAACTGGG - Intronic
1059152733 9:111963998-111964020 GTATCAAATCACCACAAACTTGG - Intergenic
1060416176 9:123432374-123432396 TGAGAAATGCACCACCAATTAGG + Intronic
1061288142 9:129635828-129635850 GAAGGAAACCACCCCCAACTTGG + Exonic
1062751891 9:138261134-138261156 GTAGGAGATCACCACCAACCTGG + Intergenic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619886 X:1447381-1447403 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619899 X:1447473-1447495 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619930 X:1447673-1447695 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619968 X:1447950-1447972 TTGGAAAAGCACCACCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620041 X:1448441-1448463 TTGGAAAAGCACCACCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620076 X:1448698-1448720 TTGGAGAAGCACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1185876783 X:3708330-3708352 GTAGCAAAACACCACCGACTGGG - Intronic
1186547890 X:10469866-10469888 GTGGAAAAGCACACACAACTGGG + Intronic
1186801154 X:13093392-13093414 GTAACAAATGACCACCAACTTGG - Intergenic
1186989209 X:15049560-15049582 ATAACAAAGCACCACCAATTAGG - Intergenic
1187299194 X:18031496-18031518 GTAATAAAGCACCACAAACTGGG - Intergenic
1187588864 X:20693569-20693591 GTAGAGAAGGACCACCAGGTGGG - Intergenic
1187681432 X:21771099-21771121 GTAGGGAAGGACCACCAGCTGGG - Intergenic
1188457489 X:30383173-30383195 GTAAAAAAGCACCACAATCTTGG - Intergenic
1188774882 X:34203734-34203756 ATAATAAAGCACCACAAACTGGG + Intergenic
1189079541 X:37956176-37956198 ATAGACAAGAACCAGCAACTAGG - Intronic
1189343179 X:40220023-40220045 GTAACAAAGTACCACAAACTGGG + Intergenic
1189458300 X:41214020-41214042 GTAGAAAATGACCATAAACTGGG + Intronic
1189687308 X:43578411-43578433 AAAAAAAAGCACCACAAACTGGG + Intergenic
1192696101 X:73417456-73417478 GTAGAAAAGCAAAGCCCACTTGG - Intergenic
1193631882 X:83899531-83899553 GTAGAGAAGGACCATCAAATAGG - Intergenic
1195010740 X:100730766-100730788 GTAGAAAAGCACCACCAACTTGG - Intronic
1196702504 X:118687004-118687026 GTAGAAAACCACCACAGATTTGG + Intergenic
1197846408 X:130808558-130808580 GTACAAAAATACCACCAATTAGG + Intronic
1198487271 X:137100159-137100181 ATAACAAAGCACCACAAACTTGG - Intergenic
1198573958 X:137989630-137989652 GTAACAAAGTACCACAAACTGGG + Intergenic
1198712053 X:139515081-139515103 GTAACAAAGCACCACAAATTTGG - Intergenic
1198865114 X:141114238-141114260 GAAGAAAAACACCACCAAAAAGG + Intergenic
1199493343 X:148425665-148425687 GTAATAAAGTACCACAAACTTGG + Intergenic
1200332693 X:155314078-155314100 GTAGAGAAAGACCACCAAGTGGG - Intronic
1200788565 Y:7279946-7279968 GTAGCAAAATACCACCGACTGGG + Intergenic
1201014593 Y:9587512-9587534 ATAGTAAAACACCACAAACTAGG - Intergenic
1201989751 Y:20010513-20010535 GTAGAAAAGCACCAGAGACAGGG + Intergenic
1202384359 Y:24310571-24310593 GTAATAAAGTACCACAAACTGGG + Intergenic
1202486424 Y:25359551-25359573 GTAATAAAGTACCACAAACTGGG - Intergenic