ID: 1195011498

View in Genome Browser
Species Human (GRCh38)
Location X:100736266-100736288
Sequence CCTTCTTTGCAGGTGGTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195011487_1195011498 24 Left 1195011487 X:100736219-100736241 CCCCCCAAATCTGGCCTGTGGGA No data
Right 1195011498 X:100736266-100736288 CCTTCTTTGCAGGTGGTGCTTGG No data
1195011484_1195011498 27 Left 1195011484 X:100736216-100736238 CCGCCCCCCAAATCTGGCCTGTG No data
Right 1195011498 X:100736266-100736288 CCTTCTTTGCAGGTGGTGCTTGG No data
1195011494_1195011498 -6 Left 1195011494 X:100736249-100736271 CCAGGCACTTCTCTGCTCCTTCT No data
Right 1195011498 X:100736266-100736288 CCTTCTTTGCAGGTGGTGCTTGG No data
1195011488_1195011498 23 Left 1195011488 X:100736220-100736242 CCCCCAAATCTGGCCTGTGGGAA No data
Right 1195011498 X:100736266-100736288 CCTTCTTTGCAGGTGGTGCTTGG No data
1195011491_1195011498 20 Left 1195011491 X:100736223-100736245 CCAAATCTGGCCTGTGGGAACTC No data
Right 1195011498 X:100736266-100736288 CCTTCTTTGCAGGTGGTGCTTGG No data
1195011493_1195011498 10 Left 1195011493 X:100736233-100736255 CCTGTGGGAACTCATACCAGGCA No data
Right 1195011498 X:100736266-100736288 CCTTCTTTGCAGGTGGTGCTTGG No data
1195011489_1195011498 22 Left 1195011489 X:100736221-100736243 CCCCAAATCTGGCCTGTGGGAAC No data
Right 1195011498 X:100736266-100736288 CCTTCTTTGCAGGTGGTGCTTGG No data
1195011490_1195011498 21 Left 1195011490 X:100736222-100736244 CCCAAATCTGGCCTGTGGGAACT No data
Right 1195011498 X:100736266-100736288 CCTTCTTTGCAGGTGGTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195011498 Original CRISPR CCTTCTTTGCAGGTGGTGCT TGG Intergenic
No off target data available for this crispr