ID: 1195016363

View in Genome Browser
Species Human (GRCh38)
Location X:100785588-100785610
Sequence CTGCATATGCAGAAGCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195016363_1195016365 -3 Left 1195016363 X:100785588-100785610 CCTGTCTGCTTCTGCATATGCAG No data
Right 1195016365 X:100785608-100785630 CAGAGAGCAATCTTCAGCTTGGG No data
1195016363_1195016370 22 Left 1195016363 X:100785588-100785610 CCTGTCTGCTTCTGCATATGCAG No data
Right 1195016370 X:100785633-100785655 CCCATCACTAGGTAAGAAACTGG No data
1195016363_1195016372 27 Left 1195016363 X:100785588-100785610 CCTGTCTGCTTCTGCATATGCAG No data
Right 1195016372 X:100785638-100785660 CACTAGGTAAGAAACTGGTTTGG 0: 9
1: 16
2: 9
3: 9
4: 111
1195016363_1195016364 -4 Left 1195016363 X:100785588-100785610 CCTGTCTGCTTCTGCATATGCAG No data
Right 1195016364 X:100785607-100785629 GCAGAGAGCAATCTTCAGCTTGG No data
1195016363_1195016366 11 Left 1195016363 X:100785588-100785610 CCTGTCTGCTTCTGCATATGCAG No data
Right 1195016366 X:100785622-100785644 CAGCTTGGGCCCCCATCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195016363 Original CRISPR CTGCATATGCAGAAGCAGAC AGG (reversed) Intergenic
No off target data available for this crispr