ID: 1195016454 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:100786366-100786388 |
| Sequence | ACCCTGCTGGAGTTTCTAAG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1195016454_1195016456 | -4 | Left | 1195016454 | X:100786366-100786388 | CCTCTTAGAAACTCCAGCAGGGT | No data | ||
| Right | 1195016456 | X:100786385-100786407 | GGGTATATGCAAAATACTTATGG | No data | ||||
| 1195016454_1195016457 | 27 | Left | 1195016454 | X:100786366-100786388 | CCTCTTAGAAACTCCAGCAGGGT | No data | ||
| Right | 1195016457 | X:100786416-100786438 | CATGCAAATATTTAACCAAGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1195016454 | Original CRISPR | ACCCTGCTGGAGTTTCTAAG AGG (reversed) | Intergenic | ||