ID: 1195016454

View in Genome Browser
Species Human (GRCh38)
Location X:100786366-100786388
Sequence ACCCTGCTGGAGTTTCTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195016454_1195016456 -4 Left 1195016454 X:100786366-100786388 CCTCTTAGAAACTCCAGCAGGGT No data
Right 1195016456 X:100786385-100786407 GGGTATATGCAAAATACTTATGG No data
1195016454_1195016457 27 Left 1195016454 X:100786366-100786388 CCTCTTAGAAACTCCAGCAGGGT No data
Right 1195016457 X:100786416-100786438 CATGCAAATATTTAACCAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195016454 Original CRISPR ACCCTGCTGGAGTTTCTAAG AGG (reversed) Intergenic