ID: 1195017518

View in Genome Browser
Species Human (GRCh38)
Location X:100793907-100793929
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195017518_1195017526 4 Left 1195017518 X:100793907-100793929 CCTGAAACAGCCCTATATTCCCT No data
Right 1195017526 X:100793934-100793956 AGAAACTAAGCGGGAGAGGATGG No data
1195017518_1195017525 0 Left 1195017518 X:100793907-100793929 CCTGAAACAGCCCTATATTCCCT No data
Right 1195017525 X:100793930-100793952 GTAAAGAAACTAAGCGGGAGAGG No data
1195017518_1195017527 17 Left 1195017518 X:100793907-100793929 CCTGAAACAGCCCTATATTCCCT No data
Right 1195017527 X:100793947-100793969 GAGAGGATGGAAATTTGTGCAGG No data
1195017518_1195017522 -5 Left 1195017518 X:100793907-100793929 CCTGAAACAGCCCTATATTCCCT No data
Right 1195017522 X:100793925-100793947 TCCCTGTAAAGAAACTAAGCGGG No data
1195017518_1195017529 26 Left 1195017518 X:100793907-100793929 CCTGAAACAGCCCTATATTCCCT No data
Right 1195017529 X:100793956-100793978 GAAATTTGTGCAGGAATTGAGGG No data
1195017518_1195017528 25 Left 1195017518 X:100793907-100793929 CCTGAAACAGCCCTATATTCCCT No data
Right 1195017528 X:100793955-100793977 GGAAATTTGTGCAGGAATTGAGG No data
1195017518_1195017521 -6 Left 1195017518 X:100793907-100793929 CCTGAAACAGCCCTATATTCCCT No data
Right 1195017521 X:100793924-100793946 TTCCCTGTAAAGAAACTAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195017518 Original CRISPR AGGGAATATAGGGCTGTTTC AGG (reversed) Intergenic
No off target data available for this crispr