ID: 1195017520

View in Genome Browser
Species Human (GRCh38)
Location X:100793918-100793940
Sequence AGTTTCTTTACAGGGAATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195017520_1195017528 14 Left 1195017520 X:100793918-100793940 CCTATATTCCCTGTAAAGAAACT No data
Right 1195017528 X:100793955-100793977 GGAAATTTGTGCAGGAATTGAGG No data
1195017520_1195017526 -7 Left 1195017520 X:100793918-100793940 CCTATATTCCCTGTAAAGAAACT No data
Right 1195017526 X:100793934-100793956 AGAAACTAAGCGGGAGAGGATGG No data
1195017520_1195017529 15 Left 1195017520 X:100793918-100793940 CCTATATTCCCTGTAAAGAAACT No data
Right 1195017529 X:100793956-100793978 GAAATTTGTGCAGGAATTGAGGG No data
1195017520_1195017527 6 Left 1195017520 X:100793918-100793940 CCTATATTCCCTGTAAAGAAACT No data
Right 1195017527 X:100793947-100793969 GAGAGGATGGAAATTTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195017520 Original CRISPR AGTTTCTTTACAGGGAATAT AGG (reversed) Intergenic
No off target data available for this crispr