ID: 1195017522

View in Genome Browser
Species Human (GRCh38)
Location X:100793925-100793947
Sequence TCCCTGTAAAGAAACTAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195017517_1195017522 -4 Left 1195017517 X:100793906-100793928 CCCTGAAACAGCCCTATATTCCC No data
Right 1195017522 X:100793925-100793947 TCCCTGTAAAGAAACTAAGCGGG No data
1195017518_1195017522 -5 Left 1195017518 X:100793907-100793929 CCTGAAACAGCCCTATATTCCCT No data
Right 1195017522 X:100793925-100793947 TCCCTGTAAAGAAACTAAGCGGG No data
1195017515_1195017522 7 Left 1195017515 X:100793895-100793917 CCTGCACAATCCCCTGAAACAGC No data
Right 1195017522 X:100793925-100793947 TCCCTGTAAAGAAACTAAGCGGG No data
1195017514_1195017522 8 Left 1195017514 X:100793894-100793916 CCCTGCACAATCCCCTGAAACAG No data
Right 1195017522 X:100793925-100793947 TCCCTGTAAAGAAACTAAGCGGG No data
1195017516_1195017522 -3 Left 1195017516 X:100793905-100793927 CCCCTGAAACAGCCCTATATTCC No data
Right 1195017522 X:100793925-100793947 TCCCTGTAAAGAAACTAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195017522 Original CRISPR TCCCTGTAAAGAAACTAAGC GGG Intergenic
No off target data available for this crispr