ID: 1195017524

View in Genome Browser
Species Human (GRCh38)
Location X:100793927-100793949
Sequence CTCCCGCTTAGTTTCTTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195017524_1195017527 -3 Left 1195017524 X:100793927-100793949 CCTGTAAAGAAACTAAGCGGGAG No data
Right 1195017527 X:100793947-100793969 GAGAGGATGGAAATTTGTGCAGG No data
1195017524_1195017528 5 Left 1195017524 X:100793927-100793949 CCTGTAAAGAAACTAAGCGGGAG No data
Right 1195017528 X:100793955-100793977 GGAAATTTGTGCAGGAATTGAGG No data
1195017524_1195017529 6 Left 1195017524 X:100793927-100793949 CCTGTAAAGAAACTAAGCGGGAG No data
Right 1195017529 X:100793956-100793978 GAAATTTGTGCAGGAATTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195017524 Original CRISPR CTCCCGCTTAGTTTCTTTAC AGG (reversed) Intergenic
No off target data available for this crispr