ID: 1195017527

View in Genome Browser
Species Human (GRCh38)
Location X:100793947-100793969
Sequence GAGAGGATGGAAATTTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195017518_1195017527 17 Left 1195017518 X:100793907-100793929 CCTGAAACAGCCCTATATTCCCT No data
Right 1195017527 X:100793947-100793969 GAGAGGATGGAAATTTGTGCAGG No data
1195017520_1195017527 6 Left 1195017520 X:100793918-100793940 CCTATATTCCCTGTAAAGAAACT No data
Right 1195017527 X:100793947-100793969 GAGAGGATGGAAATTTGTGCAGG No data
1195017514_1195017527 30 Left 1195017514 X:100793894-100793916 CCCTGCACAATCCCCTGAAACAG No data
Right 1195017527 X:100793947-100793969 GAGAGGATGGAAATTTGTGCAGG No data
1195017519_1195017527 7 Left 1195017519 X:100793917-100793939 CCCTATATTCCCTGTAAAGAAAC No data
Right 1195017527 X:100793947-100793969 GAGAGGATGGAAATTTGTGCAGG No data
1195017517_1195017527 18 Left 1195017517 X:100793906-100793928 CCCTGAAACAGCCCTATATTCCC No data
Right 1195017527 X:100793947-100793969 GAGAGGATGGAAATTTGTGCAGG No data
1195017523_1195017527 -2 Left 1195017523 X:100793926-100793948 CCCTGTAAAGAAACTAAGCGGGA No data
Right 1195017527 X:100793947-100793969 GAGAGGATGGAAATTTGTGCAGG No data
1195017524_1195017527 -3 Left 1195017524 X:100793927-100793949 CCTGTAAAGAAACTAAGCGGGAG No data
Right 1195017527 X:100793947-100793969 GAGAGGATGGAAATTTGTGCAGG No data
1195017516_1195017527 19 Left 1195017516 X:100793905-100793927 CCCCTGAAACAGCCCTATATTCC No data
Right 1195017527 X:100793947-100793969 GAGAGGATGGAAATTTGTGCAGG No data
1195017515_1195017527 29 Left 1195017515 X:100793895-100793917 CCTGCACAATCCCCTGAAACAGC No data
Right 1195017527 X:100793947-100793969 GAGAGGATGGAAATTTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195017527 Original CRISPR GAGAGGATGGAAATTTGTGC AGG Intergenic
No off target data available for this crispr