ID: 1195017528

View in Genome Browser
Species Human (GRCh38)
Location X:100793955-100793977
Sequence GGAAATTTGTGCAGGAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195017516_1195017528 27 Left 1195017516 X:100793905-100793927 CCCCTGAAACAGCCCTATATTCC No data
Right 1195017528 X:100793955-100793977 GGAAATTTGTGCAGGAATTGAGG No data
1195017520_1195017528 14 Left 1195017520 X:100793918-100793940 CCTATATTCCCTGTAAAGAAACT No data
Right 1195017528 X:100793955-100793977 GGAAATTTGTGCAGGAATTGAGG No data
1195017523_1195017528 6 Left 1195017523 X:100793926-100793948 CCCTGTAAAGAAACTAAGCGGGA No data
Right 1195017528 X:100793955-100793977 GGAAATTTGTGCAGGAATTGAGG No data
1195017524_1195017528 5 Left 1195017524 X:100793927-100793949 CCTGTAAAGAAACTAAGCGGGAG No data
Right 1195017528 X:100793955-100793977 GGAAATTTGTGCAGGAATTGAGG No data
1195017518_1195017528 25 Left 1195017518 X:100793907-100793929 CCTGAAACAGCCCTATATTCCCT No data
Right 1195017528 X:100793955-100793977 GGAAATTTGTGCAGGAATTGAGG No data
1195017519_1195017528 15 Left 1195017519 X:100793917-100793939 CCCTATATTCCCTGTAAAGAAAC No data
Right 1195017528 X:100793955-100793977 GGAAATTTGTGCAGGAATTGAGG No data
1195017517_1195017528 26 Left 1195017517 X:100793906-100793928 CCCTGAAACAGCCCTATATTCCC No data
Right 1195017528 X:100793955-100793977 GGAAATTTGTGCAGGAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195017528 Original CRISPR GGAAATTTGTGCAGGAATTG AGG Intergenic
No off target data available for this crispr