ID: 1195017911

View in Genome Browser
Species Human (GRCh38)
Location X:100796814-100796836
Sequence GATGGGGGATCATACTTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195017903_1195017911 10 Left 1195017903 X:100796781-100796803 CCACTGTGGGGAGTCCCCTGTGA No data
Right 1195017911 X:100796814-100796836 GATGGGGGATCATACTTTACTGG No data
1195017907_1195017911 -6 Left 1195017907 X:100796797-100796819 CCTGTGAACTTCACAGTGATGGG No data
Right 1195017911 X:100796814-100796836 GATGGGGGATCATACTTTACTGG No data
1195017902_1195017911 11 Left 1195017902 X:100796780-100796802 CCCACTGTGGGGAGTCCCCTGTG No data
Right 1195017911 X:100796814-100796836 GATGGGGGATCATACTTTACTGG No data
1195017898_1195017911 29 Left 1195017898 X:100796762-100796784 CCTACTAGAAAAAATTGTCCCAC No data
Right 1195017911 X:100796814-100796836 GATGGGGGATCATACTTTACTGG No data
1195017905_1195017911 -5 Left 1195017905 X:100796796-100796818 CCCTGTGAACTTCACAGTGATGG No data
Right 1195017911 X:100796814-100796836 GATGGGGGATCATACTTTACTGG No data
1195017904_1195017911 -4 Left 1195017904 X:100796795-100796817 CCCCTGTGAACTTCACAGTGATG No data
Right 1195017911 X:100796814-100796836 GATGGGGGATCATACTTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195017911 Original CRISPR GATGGGGGATCATACTTTAC TGG Intergenic
No off target data available for this crispr