ID: 1195017939

View in Genome Browser
Species Human (GRCh38)
Location X:100796999-100797021
Sequence CGTAGTATAAGCAGCACTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195017939_1195017942 -8 Left 1195017939 X:100796999-100797021 CCCCTAGTGCTGCTTATACTACG No data
Right 1195017942 X:100797014-100797036 ATACTACGATCCACTCCTTTTGG No data
1195017939_1195017945 28 Left 1195017939 X:100796999-100797021 CCCCTAGTGCTGCTTATACTACG No data
Right 1195017945 X:100797050-100797072 TCTCCTTATGAAATTATAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195017939 Original CRISPR CGTAGTATAAGCAGCACTAG GGG (reversed) Intergenic
No off target data available for this crispr