ID: 1195018168

View in Genome Browser
Species Human (GRCh38)
Location X:100798851-100798873
Sequence GAGTAGTTGGTTTGGATCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195018163_1195018168 -3 Left 1195018163 X:100798831-100798853 CCCTCACTAATCAATTGGTTGAG No data
Right 1195018168 X:100798851-100798873 GAGTAGTTGGTTTGGATCCTGGG No data
1195018161_1195018168 13 Left 1195018161 X:100798815-100798837 CCTGTCAGATCTAAAACCCTCAC No data
Right 1195018168 X:100798851-100798873 GAGTAGTTGGTTTGGATCCTGGG No data
1195018160_1195018168 17 Left 1195018160 X:100798811-100798833 CCAACCTGTCAGATCTAAAACCC No data
Right 1195018168 X:100798851-100798873 GAGTAGTTGGTTTGGATCCTGGG No data
1195018164_1195018168 -4 Left 1195018164 X:100798832-100798854 CCTCACTAATCAATTGGTTGAGT No data
Right 1195018168 X:100798851-100798873 GAGTAGTTGGTTTGGATCCTGGG No data
1195018158_1195018168 26 Left 1195018158 X:100798802-100798824 CCCAGATAACCAACCTGTCAGAT 0: 5
1: 2
2: 3
3: 10
4: 106
Right 1195018168 X:100798851-100798873 GAGTAGTTGGTTTGGATCCTGGG No data
1195018159_1195018168 25 Left 1195018159 X:100798803-100798825 CCAGATAACCAACCTGTCAGATC 0: 6
1: 2
2: 3
3: 9
4: 102
Right 1195018168 X:100798851-100798873 GAGTAGTTGGTTTGGATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195018168 Original CRISPR GAGTAGTTGGTTTGGATCCT GGG Intergenic
No off target data available for this crispr