ID: 1195021935

View in Genome Browser
Species Human (GRCh38)
Location X:100837428-100837450
Sequence CACTCCACAGGATCATGAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 1, 2: 1, 3: 6, 4: 121}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195021927_1195021935 13 Left 1195021927 X:100837392-100837414 CCAGCCTGGCGGCTTTAGTCCCG 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1195021935 X:100837428-100837450 CACTCCACAGGATCATGAGAAGG 0: 1
1: 1
2: 1
3: 6
4: 121
1195021932_1195021935 -7 Left 1195021932 X:100837412-100837434 CCGGGCAGAACCAAGTCACTCCA 0: 1
1: 0
2: 1
3: 13
4: 146
Right 1195021935 X:100837428-100837450 CACTCCACAGGATCATGAGAAGG 0: 1
1: 1
2: 1
3: 6
4: 121
1195021931_1195021935 -6 Left 1195021931 X:100837411-100837433 CCCGGGCAGAACCAAGTCACTCC 0: 1
1: 0
2: 2
3: 10
4: 149
Right 1195021935 X:100837428-100837450 CACTCCACAGGATCATGAGAAGG 0: 1
1: 1
2: 1
3: 6
4: 121
1195021930_1195021935 9 Left 1195021930 X:100837396-100837418 CCTGGCGGCTTTAGTCCCGGGCA 0: 1
1: 0
2: 1
3: 4
4: 61
Right 1195021935 X:100837428-100837450 CACTCCACAGGATCATGAGAAGG 0: 1
1: 1
2: 1
3: 6
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195021935 Original CRISPR CACTCCACAGGATCATGAGA AGG Exonic
900910232 1:5592174-5592196 CACTAACAAGGATCATGAGATGG + Intergenic
902919385 1:19657150-19657172 CATTCCACAGGGGGATGAGAGGG - Exonic
905769505 1:40628441-40628463 TACTCCACAGGATCATCTGCAGG + Intronic
905925020 1:41743535-41743557 CAAACCACAGGATAAGGAGATGG + Intronic
906123169 1:43408801-43408823 CACTCTACAGGCCCATGGGAAGG - Intronic
907104424 1:51868832-51868854 CACTGCACTGCATCCTGAGAGGG + Intronic
921717714 1:218435291-218435313 CACTCCAGAGAATCATGACTAGG - Intronic
922489344 1:226003023-226003045 CACTGGAAAGGAGCATGAGAGGG + Intergenic
1066047967 10:31610993-31611015 CACTGCCCAGCATCAAGAGAGGG + Intergenic
1068030237 10:51697821-51697843 CACTCCACAGGATCAGGAGAAGG - Exonic
1072970405 10:100012287-100012309 AACTCCACAAGGTCAGGAGATGG - Intergenic
1076667783 10:132102819-132102841 CAGTCCACAGGACCATGGGAGGG - Intergenic
1076717057 10:132371525-132371547 CACTCCTCAGGATGAGGAAATGG + Intronic
1077264195 11:1641019-1641041 AACTCCCCAGGAAAATGAGATGG - Intergenic
1080344562 11:31310050-31310072 AACTCCACATGATCCTGATAGGG + Intronic
1080600743 11:33819043-33819065 CACTCCACAGGGGCAGAAGAGGG - Intergenic
1082190688 11:49239723-49239745 GATTCCACAGGTACATGAGATGG - Intergenic
1084678226 11:70649288-70649310 CTCTCCCCAGGATCTTCAGATGG - Intronic
1085101536 11:73804697-73804719 CCATGCACAGCATCATGAGAGGG - Intronic
1086675434 11:89601194-89601216 GATTCCACAGGTACATGAGATGG + Intergenic
1088736635 11:112733006-112733028 CACTCCGATGCATCATGAGAGGG + Intergenic
1088754254 11:112872597-112872619 CACTCCCCAGGACCATCAGCTGG - Intergenic
1089304123 11:117516208-117516230 CACACCCCAGGTGCATGAGAGGG - Intronic
1091979114 12:4851235-4851257 CACTACACAGGAGGATGTGATGG + Intronic
1096200044 12:49675018-49675040 TCCTCCACCGGATCCTGAGAAGG + Intronic
1098383961 12:69898843-69898865 CACACAACAGCAACATGAGAGGG + Intronic
1103926557 12:124426650-124426672 CACTCCACATGTTCATGACCTGG + Exonic
1104290657 12:127463827-127463849 GACTCCTCAGTATAATGAGAGGG + Intergenic
1104590005 12:130076512-130076534 TACTCCACAGCATCTGGAGAAGG - Intergenic
1105531983 13:21228862-21228884 TACTCTACAGGACCATCAGAAGG + Intergenic
1105704999 13:22963182-22963204 CACTCCCCAGGATGGTGAGGAGG + Intergenic
1105857958 13:24388360-24388382 CACTCCTCAGGATGGTGAGGAGG + Intergenic
1110918365 13:81052075-81052097 CTTTCCACAGGGTCAGGAGAGGG - Intergenic
1111097364 13:83533694-83533716 CACTCCAGAGGAGTATGAGCTGG - Intergenic
1112763239 13:102713816-102713838 CACTCCACAGCAGCATGTGGTGG - Intergenic
1118780110 14:69002265-69002287 CAGTCCACAGGCTCATGACCTGG - Intergenic
1119229410 14:72968605-72968627 CACTGCACAGGATCATGGTTTGG + Intergenic
1122195129 14:100079024-100079046 CACTCCAGAGGAGCAGAAGAGGG + Intronic
1124089027 15:26580211-26580233 CACAGCACAGGATCATCGGAAGG - Intronic
1129968356 15:79756643-79756665 CACTCCACAGGATCATGGTTTGG + Intergenic
1133386282 16:5372824-5372846 GATTCCAAAGGATCATGAGATGG - Intergenic
1135071528 16:19356307-19356329 CTCTCCCCAGGTCCATGAGATGG - Intergenic
1137714681 16:50591517-50591539 GACTCCACAGGCTCAGGAGAGGG - Intronic
1143735058 17:8905725-8905747 CTCTCCACAGGTCCAGGAGAAGG - Exonic
1145988640 17:29064670-29064692 CACACCTCAGGATGCTGAGATGG - Intergenic
1146309864 17:31759455-31759477 CACTGCACAAGGTCATCAGAGGG - Intergenic
1147777427 17:42912415-42912437 CACCCCACTGGATCTTCAGAAGG + Exonic
1153728360 18:7980864-7980886 CCCTCCACTGGAGCATGAGCTGG + Intronic
1155483195 18:26312022-26312044 CACTCCATAGAATCTTGAGTTGG + Intronic
1155790218 18:29957963-29957985 CAATCCACCTGATTATGAGAAGG + Intergenic
925508077 2:4592009-4592031 CTCTCCACAGGAACCTGACATGG - Intergenic
925808632 2:7676512-7676534 CACACGGCAGGATCAAGAGAGGG - Intergenic
926854913 2:17244832-17244854 CAATGTACAGGATCATGATAGGG - Intergenic
927102644 2:19799850-19799872 CACTACACAGGATCTGGATAGGG + Intergenic
927234303 2:20856260-20856282 CACTCCACAGGAGCTTGTTATGG - Intergenic
928126079 2:28617594-28617616 CACCATACAGGATCATGTGAGGG - Intronic
928704492 2:33933335-33933357 AATTCCACAAGATCATGAGCAGG + Intergenic
929315360 2:40471511-40471533 CACTCCATAGGATCAGGGGTGGG - Intronic
929873573 2:45777895-45777917 CACACCAAAGGTTCTTGAGATGG + Intronic
929964179 2:46521301-46521323 AAATCCACAGCACCATGAGAGGG + Intronic
931199020 2:60079137-60079159 CACTCCACAGGATTCTGATCAGG + Intergenic
931486972 2:62703947-62703969 CAATCCACATGATGATCAGAAGG - Intronic
931578268 2:63743621-63743643 CAGTCCACAGCATTAAGAGATGG + Intronic
932474774 2:71996284-71996306 CACTCTAAAGGTTCATGAGTTGG - Intergenic
932547792 2:72733106-72733128 CTCTCCACAGAATCAAGTGACGG - Exonic
934759842 2:96848432-96848454 CTCTCCACAGGCTGCTGAGAGGG - Exonic
935622991 2:105144641-105144663 CACTGCACAGGGATATGAGATGG - Intergenic
935857058 2:107286420-107286442 AACACCACAAGATCATGACAAGG + Intergenic
939688298 2:145226614-145226636 CATTCCACAGGTTGATGGGAAGG - Intergenic
943722851 2:191223118-191223140 CACTGCAAAGGATCATTTGATGG + Intergenic
943780212 2:191815335-191815357 CTTTCTACAGGATCAGGAGAGGG - Intergenic
945687462 2:212989069-212989091 AACCCCATAGAATCATGAGAAGG + Intergenic
1170212578 20:13860213-13860235 GACACCACAGGATAAAGAGAGGG - Intronic
1172172112 20:32943574-32943596 CACTACACAGGCTAATTAGAAGG - Intronic
1174271590 20:49373459-49373481 CACTCCCCCGGTTCCTGAGAGGG + Exonic
1175563726 20:59955267-59955289 CACTCCTCAAAAACATGAGAAGG + Intergenic
1175781531 20:61685375-61685397 CTCCCCACAGGCTCATGACAGGG + Intronic
1179120460 21:38540573-38540595 CATTCCACTGGAGCAAGAGAGGG - Intronic
1180051191 21:45331734-45331756 CACTCCACAGCGTGCTGAGAGGG - Intergenic
1182859869 22:33549989-33550011 CAGTCCACAGGGTCAGGGGATGG + Intronic
952887191 3:38019008-38019030 CACTGGACAGGACCCTGAGAAGG - Intronic
956087113 3:65623423-65623445 CAGTCTACAGGATCAACAGAAGG + Intronic
961904651 3:130250573-130250595 CACTCAGCAGGAGCCTGAGAAGG + Intergenic
962945858 3:140169815-140169837 AGCTACCCAGGATCATGAGATGG + Intronic
963860602 3:150306012-150306034 CAGTCCAGAGGACCATGAAAGGG - Intergenic
968067028 3:195764392-195764414 CACTGCCCAAGGTCATGAGAAGG - Intronic
968189839 3:196659844-196659866 GATTCCACAGGGTCTTGAGAGGG - Exonic
974850312 4:67396446-67396468 CACCTCATAGGATCATGGGAAGG + Intergenic
975980048 4:80147106-80147128 CACTCCAGAGGATTTTGAGGAGG - Intergenic
977577852 4:98693807-98693829 CACTTCACAGGATTGTGGGAAGG + Intergenic
985118752 4:186618218-186618240 CACTCAAGATGACCATGAGATGG - Exonic
985284029 4:188316157-188316179 CTCTCCAAATGTTCATGAGAGGG - Intergenic
985802492 5:2013851-2013873 CACTCCACAGGGACGGGAGACGG + Intergenic
985988865 5:3538869-3538891 CACTCCACAGTGTCATAAGGAGG + Intergenic
988488010 5:31682894-31682916 CACTCCCCATGATCGGGAGAAGG - Intronic
992299461 5:75363606-75363628 CACTCCACAGGTTGAAGAGATGG - Intergenic
995066245 5:107866480-107866502 CACACCACAGTTTCATGATATGG + Intronic
997454383 5:134006167-134006189 CACTCCTCAGGATCTTGAAGGGG - Intergenic
998098475 5:139412139-139412161 CATTCCACAGAGTCAGGAGATGG - Exonic
998992957 5:147838893-147838915 CCCTCTTCAGGACCATGAGATGG - Intergenic
999419992 5:151432473-151432495 CACATCACAGGGTCAGGAGAGGG + Intergenic
1004579500 6:16935180-16935202 TACTCCACAGGAGCATGAAGTGG + Intergenic
1006779600 6:36623383-36623405 CACTCCACTGGCACAGGAGATGG - Intergenic
1012791186 6:103698472-103698494 CACTTCAAAGGATCCTGCGAGGG + Intergenic
1017924011 6:158895430-158895452 CACACCTCATGCTCATGAGAGGG + Intronic
1018672848 6:166193970-166193992 CACTCCACTGGATCTTGATGTGG - Intergenic
1019747970 7:2711142-2711164 CCCTCCACAGCCTCAGGAGATGG - Intronic
1020415567 7:7941977-7941999 AACGCCACCGGATCCTGAGAGGG - Intronic
1022671845 7:32463091-32463113 CTCTCCACAGCAACATGAGCTGG + Intergenic
1034477735 7:151296838-151296860 CAATCCACAAGTTCATCAGAAGG - Intergenic
1035917116 8:3636664-3636686 CTCTCCACAGGATCAAGACTAGG - Intronic
1039326989 8:36496518-36496540 TACTCCAAAGTACCATGAGAAGG + Intergenic
1040948647 8:52912932-52912954 CACTCCACAGGTTCACAGGAAGG - Intergenic
1041066495 8:54087090-54087112 CAGCTCACAAGATCATGAGAGGG - Intronic
1047440369 8:124872282-124872304 CACTCTGCAGGATCATGAGAGGG - Intergenic
1048922928 8:139247109-139247131 CAGGCCACAAGATAATGAGATGG + Intergenic
1049577004 8:143394140-143394162 CCCTCAACAGGATTCTGAGATGG + Intergenic
1049588371 8:143442179-143442201 CACACCACAGGATCCAGGGAAGG - Intronic
1051328530 9:15999096-15999118 AACTACACAGGATGCTGAGATGG + Intronic
1052034861 9:23669072-23669094 CCACCCACAGCATCATGAGAAGG + Intergenic
1053473232 9:38361594-38361616 CTCTTCACAGGATCCTCAGAAGG - Intergenic
1057282715 9:93724477-93724499 CTCTCCACAGGCTTCTGAGAGGG - Intergenic
1058074783 9:100639515-100639537 CACTACACAGAAACAAGAGATGG - Intergenic
1058140929 9:101356423-101356445 AAATTCACACGATCATGAGAAGG + Intergenic
1058375730 9:104319380-104319402 CGCTTCACAGGGACATGAGAGGG - Intergenic
1185986527 X:4841235-4841257 CAATCCACAGGATCATCCCATGG + Intergenic
1188728573 X:33616447-33616469 AACTCCACAGGATGTTGACATGG + Intergenic
1189266331 X:39719610-39719632 CACTCCACATGATCTTGAGCAGG - Intergenic
1195021935 X:100837428-100837450 CACTCCACAGGATCATGAGAAGG + Exonic
1199979425 X:152912820-152912842 CACTCCACAGGTTGCTGGGATGG + Intergenic