ID: 1195023802

View in Genome Browser
Species Human (GRCh38)
Location X:100855529-100855551
Sequence CAGCTATGACAGCTGTAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 183}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195023802 Original CRISPR CAGCTATGACAGCTGTAACA AGG (reversed) Intronic
901118190 1:6866047-6866069 CAGCTTTGACATCTGTGACTTGG + Intronic
902611539 1:17600539-17600561 CAGCTTTGACAACTGTGCCAAGG - Intronic
904043180 1:27595765-27595787 CAGGTATGAGGGCTGTAACCAGG + Intronic
904901804 1:33863557-33863579 CAGGTATGACAGCTGTGACTTGG - Exonic
904963105 1:34350135-34350157 CAGCTTTTAAATCTGTAACATGG + Intergenic
905043929 1:34981896-34981918 CAGCTGTCACAGCAGGAACATGG - Exonic
906211183 1:44013121-44013143 CAGCAGTTACAGCTGTAAAAGGG + Intronic
906800590 1:48733725-48733747 CAGCTAAGAAATCTGAAACATGG + Intronic
910374874 1:86557360-86557382 CAGCTAAGACAGTTTTAAGAGGG - Intronic
911442812 1:97949861-97949883 CAGCTAATACAGTTGTAAAAAGG - Intergenic
913047025 1:115082905-115082927 CAGCTTTCACAACTGTAAAATGG + Intronic
913969062 1:143400528-143400550 AAGGTATGACAGCTGGATCAGGG - Intergenic
914063439 1:144226127-144226149 AAGGTATGACAGCTGGATCAGGG - Intergenic
914115711 1:144740227-144740249 AAGGTATGACAGCTGGATCAGGG + Intergenic
914700911 1:150132810-150132832 CAGCTTTTTCAGCTGTAAAATGG + Intronic
916162155 1:161928117-161928139 CAGTTATCTCAGCTGTAAAATGG - Intronic
918096221 1:181336433-181336455 CAGCTATGTCACCTGAGACAAGG - Intergenic
918691982 1:187492298-187492320 CTTCAATGACAGCTTTAACAAGG - Intergenic
920202034 1:204265613-204265635 CAGCAGTGACATATGTAACAAGG + Intronic
922310092 1:224380702-224380724 AAAATATGACAGATGTAACAAGG - Intergenic
922728016 1:227934114-227934136 CAGGTATGAAAGCTGGAAAATGG - Intronic
1063534789 10:6872830-6872852 CAGCCATAAGAGCTGTAACAGGG - Intergenic
1063638166 10:7805170-7805192 CAGCTTTGTCATCTGTAACATGG + Intronic
1065502547 10:26396557-26396579 CAGCTCTGCCAACTGTAACCTGG - Intergenic
1065580582 10:27167053-27167075 GAACTAAGAAAGCTGTAACATGG + Intronic
1068137398 10:52964648-52964670 CAGGTGTGCCAGCTGCAACAGGG + Intergenic
1069068122 10:63966660-63966682 CAGCTATTTTAGCTGTAACATGG + Intergenic
1070519850 10:77243164-77243186 CAGCTTTTACAGCTTTATCATGG - Intronic
1070726564 10:78795510-78795532 CAGCTATATCATCTGTAAGATGG + Intergenic
1070786333 10:79164277-79164299 CAGCTTTGCCACCTGTAAAATGG + Intronic
1070859264 10:79637739-79637761 CAGCTTCCACAGCTGTTACAAGG + Intergenic
1072579137 10:96724743-96724765 AAGCCATGACAGCTGTCTCATGG + Intergenic
1074877754 10:117627569-117627591 CAGTTTTGACAGCTGTAAAATGG - Intergenic
1074998563 10:118778599-118778621 CAGCTTTGACACCTGCAACTGGG + Intergenic
1077862231 11:6192551-6192573 CAGCTATTTCATCTGTAAAATGG + Intergenic
1083488696 11:62999267-62999289 CAGCTGTGGCATCTGTAAAATGG - Intronic
1083931576 11:65849237-65849259 CAGCTTCAACAGCTGTAAAATGG + Intronic
1084090911 11:66878937-66878959 CAGCTTTCACATCTGTAAAACGG + Intronic
1084380641 11:68810360-68810382 CAGCAATGACAGCAGTACCCAGG + Intronic
1087542697 11:99541541-99541563 CAGCTCTGACACCTGTGAAAAGG + Intronic
1098996526 12:77126979-77127001 CAGTTATGGCAGCTGAAAGAGGG + Intergenic
1099278964 12:80617963-80617985 CAGGTATGACACCTGTAAAAGGG - Intronic
1099838709 12:87939200-87939222 CAGTGATGACAGCTGTAGCCTGG - Intergenic
1103540296 12:121661550-121661572 CAGATATCTCAGCTGTAAAATGG + Intronic
1105204301 13:18207313-18207335 CAGCTATGAGAGACGCAACAAGG - Intergenic
1110301363 13:73931930-73931952 TAGCTAAGTCAGCTCTAACAAGG - Intronic
1114538719 14:23439187-23439209 CAGTTTTGTCATCTGTAACATGG + Intergenic
1123715138 15:23022882-23022904 CCAGTATGACAGCTGTAAAATGG - Intronic
1124875330 15:33586668-33586690 CAGTTATGTCATCTGTAAAATGG + Intronic
1125183461 15:36904225-36904247 AAGCTCTGACAACTGCAACAGGG + Intronic
1127460374 15:59193208-59193230 CAGCAATCTCAGCTTTAACAAGG + Intronic
1127549651 15:60024234-60024256 CAGCCATGACAGCTGGAAACTGG - Intronic
1128354847 15:66918792-66918814 CAGCTTTCTCAGCTATAACATGG + Intergenic
1130027829 15:80285145-80285167 CAGCTACCACATCTGTAAAATGG + Intergenic
1131081864 15:89543358-89543380 CAGGCTTGACAGCTGTGACAAGG + Intergenic
1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG + Intronic
1131414059 15:92236739-92236761 CAGCTCAGACAGCTGCAAAATGG + Intergenic
1131592496 15:93764890-93764912 CAGCTTTTTCAGCTGTAAAATGG + Intergenic
1131642774 15:94310612-94310634 CAGTTATGGCAGCTGTGAGAAGG + Intronic
1133421725 16:5652293-5652315 CAGCTTTCCCATCTGTAACATGG - Intergenic
1134340353 16:13339219-13339241 AAGTTATGACAGCTCTAACTTGG - Intergenic
1135127749 16:19825162-19825184 CAGTTATCTCATCTGTAACATGG + Intronic
1141040221 16:80666744-80666766 CAGCTTTGACAGATGTCAGAAGG + Intronic
1141860340 16:86712165-86712187 CAGCTCTGCCATCTGTAAAAGGG - Intergenic
1149548039 17:57518876-57518898 CAGGCTTGACAGCTGTCACATGG - Intronic
1150990966 17:70258697-70258719 CAGCTATGAGAGATGGAATATGG - Intergenic
1153136543 18:1923853-1923875 GAACTATGTCAGCTGTAATAAGG - Intergenic
1153956544 18:10101358-10101380 CAGCTCTGAGAGCTGTGCCAGGG - Intergenic
1154073806 18:11179477-11179499 CATCTGTGACAGCTGCCACATGG - Intergenic
1154333535 18:13448932-13448954 CAGTCATGGCAGCTTTAACATGG + Intronic
1158014271 18:52765689-52765711 AAGCTAAGACAAATGTAACATGG - Intronic
1159090041 18:63837736-63837758 CAGCAATAACAGCTGTTTCAGGG - Intergenic
1159278365 18:66250444-66250466 CAGGTAACACAGCTGTAACTGGG + Intergenic
1160627892 18:80225377-80225399 CAGCTATGAGAACTTTAACATGG - Intronic
1162592916 19:11604761-11604783 GAGTCATGACAGCTGTAATAGGG + Intronic
1164478865 19:28596209-28596231 CAGCCATGACAACTGAAAGAGGG + Intergenic
1164767587 19:30783707-30783729 CAGCTCTAACAGCTATCACACGG - Intergenic
1165252314 19:34549862-34549884 CAGTTATAAAAGATGTAACATGG - Intergenic
1166404548 19:42510601-42510623 CAGCTTTGTCATCTGTAAAATGG - Intronic
1166870805 19:45869355-45869377 CAGCTAGCTCAGCTGTAAAATGG + Intronic
924987010 2:281305-281327 CAGGTGTCACAGCTGTAACTGGG - Intronic
927291077 2:21405510-21405532 CAGGTATGACAGTTGTCCCAGGG - Intergenic
929024436 2:37585919-37585941 CAGCTGTGACAGCTGTAGGGTGG + Intergenic
930545124 2:52757775-52757797 CAGGTATGACAGGGGCAACAAGG + Intergenic
930875706 2:56213188-56213210 CAGCTCTGACAGCTTTCAAATGG + Intronic
931998365 2:67860869-67860891 CAGCTTTCATAGCTGTAAAAAGG + Intergenic
934173763 2:89561448-89561470 AAGGTATGACAGCTGGATCAGGG - Intergenic
934284077 2:91635797-91635819 AAGGTATGACAGCTGGATCAGGG - Intergenic
936573997 2:113638371-113638393 CAGCTGTGCCAGCAGTTACAGGG + Intronic
936907989 2:117559309-117559331 CAGCTATTTCATCTGTAACATGG + Intergenic
937539934 2:122936870-122936892 CAGCTTTGACATCTTTAAAATGG + Intergenic
938664221 2:133517741-133517763 CAACTCTGACATTTGTAACACGG - Intronic
940572307 2:155453804-155453826 CAACTATGACAGCTTCCACAGGG - Intergenic
945199023 2:207263326-207263348 CAGCTGTGAGAGCTGAAACTGGG + Intergenic
945832658 2:214805841-214805863 CATCTATGACAATTGTAACGTGG - Intronic
947922204 2:233886987-233887009 CAGTTATGTCATCTGTAAAATGG + Intergenic
1169864046 20:10181011-10181033 CAGCAATGTCAGCTGGGACATGG + Intergenic
1172160920 20:32867343-32867365 CAGCTGTGGCATCTGTAAAAAGG + Intronic
1173540641 20:43848350-43848372 CAGCTATGGCACCTGGAAAATGG + Intergenic
1177336847 21:19739693-19739715 CAGCCATGACAGTGGTAAGAGGG - Intergenic
1178313197 21:31546905-31546927 CAGCTGAGACAGTAGTAACAGGG - Intronic
1178704907 21:34865034-34865056 CAGCTTTGTCATCTGTAAAAGGG + Intronic
1181457145 22:23066251-23066273 CAGCAATGACACCTGTCCCAGGG - Intronic
1181493128 22:23273207-23273229 CAGCTATGACAACTAAAAAAAGG - Intronic
1181994468 22:26864494-26864516 CAGCTTTCACATCTGTAAAATGG + Intergenic
1182088773 22:27579915-27579937 CAGCTTTGCCATCTGTAAAATGG + Intergenic
1183941735 22:41299644-41299666 CTGCTATTTCAGCTTTAACATGG + Intergenic
1183985411 22:41567345-41567367 CAGCTATCTCATCTGTAAAATGG + Intronic
1185426176 22:50772522-50772544 CAGCTGTGCCAGCGGTTACAGGG - Intronic
949394082 3:3596266-3596288 TAGCTATTACAAGTGTAACAAGG - Intergenic
952365768 3:32673659-32673681 CACCTTTGAGAGCTGTAACAGGG - Intergenic
952411276 3:33052079-33052101 CATCTATGACAGGTGTAAAGGGG + Intronic
952565052 3:34646282-34646304 CATCTGTTACATCTGTAACATGG + Intergenic
952774526 3:37031927-37031949 CAACTAAGAAAGCTGTTACAAGG - Intronic
952937768 3:38413543-38413565 CACCTCAGACAGCTGAAACAAGG - Exonic
953734794 3:45483748-45483770 CAGCTAACACATCTGTACCATGG + Intronic
956971684 3:74533556-74533578 CAGTTATTTCATCTGTAACATGG - Intergenic
959388816 3:105747287-105747309 CTGCTTTAACAGCTTTAACATGG - Intronic
959462991 3:106650185-106650207 CAGCTAAGACAGTTGTATTAGGG + Intergenic
959998792 3:112708641-112708663 CAGCTAAGACAGCGTTAAGAGGG - Intergenic
960049920 3:113229327-113229349 CACCAATGACTGCTTTAACAAGG - Intronic
960962575 3:123082649-123082671 GAGCAAGGACAGCAGTAACACGG - Intronic
966448171 3:180027081-180027103 CAGCCATTGAAGCTGTAACATGG + Intronic
969148428 4:5144560-5144582 CAGCAGTGACAGATGTCACATGG - Intronic
969181456 4:5445383-5445405 CTGCTCTGACAACTGTAAAATGG + Intronic
969827625 4:9770276-9770298 AAGTTATGACAGCTGGATCAGGG - Intergenic
972124337 4:35744132-35744154 CAGCTAAGACAGTGGTAAGAGGG + Intergenic
974229220 4:59088439-59088461 ATGCTTTGACACCTGTAACATGG + Intergenic
975964399 4:79952997-79953019 GTTCTATGACAGCTGTATCATGG + Intronic
977181120 4:93875569-93875591 CAGCTATGAAATGTGTAGCATGG - Intergenic
978001892 4:103565730-103565752 CAGCTAAGACAGTGGTAAGAGGG + Intergenic
978651661 4:111012910-111012932 CAGCCACCATAGCTGTAACATGG - Intergenic
980477610 4:133338051-133338073 CAGCTATGGCAGTGTTAACAGGG - Intergenic
980911106 4:138995340-138995362 CTCCTATGACAGCTGTGACCTGG + Intergenic
986253048 5:6078720-6078742 CAGCTATGGCTGCTGGAACAGGG - Intergenic
986292929 5:6414858-6414880 CAGCTCTGAGAGCTGTCACTGGG + Intergenic
986523944 5:8652445-8652467 CATCTATAACAGCTGAAATAGGG + Intergenic
987338237 5:16916091-16916113 CAGCGATGACATCTTTACCAAGG - Intronic
987860198 5:23476320-23476342 CAACTCTGACAGATGTAACAGGG + Intergenic
989444181 5:41509390-41509412 CAACAATGACAGCTGGGACACGG - Intronic
991965139 5:72083300-72083322 AAGCTATGACAGCTACAACCAGG - Intergenic
992411644 5:76510965-76510987 CATCTATGACAGTTGGATCATGG + Intronic
993236044 5:85311651-85311673 CAGCTTTGACAGCTGGCACTGGG - Intergenic
993979725 5:94530767-94530789 CAGCTCTGAAAGCAGAAACAGGG - Intronic
996306215 5:122050902-122050924 CAGATAAGACAGCGTTAACAGGG - Intronic
999658611 5:153834983-153835005 CAGCTCTGACAGCTGGAAAGTGG - Intergenic
999743722 5:154576120-154576142 CAGCTTTCTCAGCTGTAAAACGG - Intergenic
999827453 5:155287650-155287672 CAGTTTTGTCAGCTATAACATGG + Intergenic
1000300755 5:159954177-159954199 CAGCTCCGGCTGCTGTAACAAGG + Intronic
1001087801 5:168714086-168714108 CAGCTAGGACAGCAGGAAGATGG + Intronic
1001533951 5:172485440-172485462 CTGCTATGACAACTGTAGCATGG + Intergenic
1001535619 5:172495923-172495945 CAGCTTTTCCAGCTGTAAAATGG - Intergenic
1001861343 5:175058314-175058336 CAGTTTTCACAGCTGTAAAATGG + Intergenic
1003287031 6:4743325-4743347 CAGCTATGAGTCCTGTAACTGGG - Intronic
1004508592 6:16266500-16266522 CACCTTTAAGAGCTGTAACACGG + Intronic
1004508677 6:16267061-16267083 CACCTTTAAGAGCTGTAACATGG + Intronic
1006715884 6:36120124-36120146 CAGTTATCACAACTGTAAAATGG + Intergenic
1007717345 6:43864963-43864985 CAGCTTTTACAGCTGGAAAAGGG - Intergenic
1008751005 6:54734082-54734104 CAGCTAAGACAGCATTAAGAGGG - Intergenic
1009395289 6:63192978-63193000 CAGCTATGTGAGTTGTATCAAGG + Intergenic
1013195380 6:107840447-107840469 AACCTATGATAGCTGAAACAGGG + Intergenic
1014300562 6:119676450-119676472 AAGCTATGACAGTGGTCACAAGG + Intergenic
1015180690 6:130359070-130359092 CAGTTATTTCAGCTGTAAAATGG + Intronic
1018417460 6:163613486-163613508 GAGCTATCTCAGCTGTAAAATGG - Intergenic
1020397795 7:7736845-7736867 CATCTCTGACAGCTGTAGCCTGG + Intronic
1020845814 7:13281704-13281726 CATCTATGTCATCTGTAAAATGG + Intergenic
1021084471 7:16406075-16406097 CAGCTGTGACAACTTTAAGAAGG + Exonic
1022568064 7:31423257-31423279 CAACCATGACAACTGTCACATGG + Intergenic
1022577915 7:31517016-31517038 CAGTTTTAAGAGCTGTAACACGG - Intronic
1024949202 7:54840557-54840579 CAGTTTTCACATCTGTAACATGG - Intergenic
1026186502 7:68085848-68085870 CAGCTGGGGCTGCTGTAACAAGG - Intergenic
1026649833 7:72206872-72206894 AAGCTGGGACAGCTGCAACATGG + Intronic
1029175691 7:98662805-98662827 CAGGAAAGACAGCTGAAACAAGG + Intergenic
1031573864 7:123392416-123392438 CAGCTCTGATAGAAGTAACAAGG + Intergenic
1031839448 7:126719641-126719663 CAGCTATCACAGCTATCACAGGG - Intronic
1033648870 7:143324853-143324875 CACCGATGACATCTCTAACAGGG + Intronic
1035369205 7:158368276-158368298 AAGCTGTGGCAGCTGTTACAGGG - Intronic
1037681423 8:21100864-21100886 CAGCCATGGCTGCTGTGACAGGG - Intergenic
1037693089 8:21199550-21199572 CAGGTATTACACCTGTAAAAAGG - Intergenic
1039672083 8:39612780-39612802 GAGCTATGGCAGCAGCAACAGGG - Intronic
1043074388 8:75677962-75677984 CAGCAATCACAGCCGTCACAAGG - Intergenic
1048759759 8:137781123-137781145 CACCTGTGACAGCTGTAGTATGG + Intergenic
1049962011 9:746113-746135 CAGCTATCAGAGATGAAACAGGG - Intergenic
1057441270 9:95085437-95085459 CAGCGATGACCTCTCTAACAAGG + Intronic
1058794011 9:108479733-108479755 CAGTTATGACAAATGTACCATGG - Intergenic
1059638160 9:116190814-116190836 CAGCTATAACCGCTGTGACCAGG + Intronic
1061345348 9:130019970-130019992 CAGCTAGAACAGCTTTAAAAGGG - Intronic
1186301280 X:8202276-8202298 CAGCTCTGGCAGCTGTGAAATGG + Intergenic
1186328395 X:8505617-8505639 CAGCTCTGACAGATGTCACGTGG + Intergenic
1189910510 X:45806130-45806152 CAGCTGTCACTGCTGTAAAATGG + Intergenic
1190762437 X:53447760-53447782 CTGCTGTGACAGCTGTACAAGGG + Intergenic
1195023802 X:100855529-100855551 CAGCTATGACAGCTGTAACAAGG - Intronic
1197699410 X:129587268-129587290 CAGCTGTGACATCTGTGACTAGG - Intronic
1198061622 X:133051274-133051296 CATATATGACAGCTGGAATAAGG + Intronic
1198494762 X:137180907-137180929 CAGCTTTAACTGCTGGAACATGG - Intergenic
1198802970 X:140466478-140466500 CAGCAATGACAGCAAGAACAAGG + Intergenic
1199150058 X:144421218-144421240 CAGCTTTGATATCTGTAAAATGG - Intergenic