ID: 1195024354

View in Genome Browser
Species Human (GRCh38)
Location X:100861342-100861364
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195024354 Original CRISPR GCTTAGTTCTCATCTGGAAC AGG (reversed) Intronic