ID: 1195024354

View in Genome Browser
Species Human (GRCh38)
Location X:100861342-100861364
Sequence GCTTAGTTCTCATCTGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 103}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195024354 Original CRISPR GCTTAGTTCTCATCTGGAAC AGG (reversed) Intronic
900854445 1:5169762-5169784 GCTGAGTTCTCATCTGATGCTGG + Intergenic
904404573 1:30277571-30277593 GCTTAGTTTTCATGTGGGAGGGG - Intergenic
907442005 1:54484790-54484812 CCTTAGCTCACAACTGGAACAGG + Intergenic
907799400 1:57749899-57749921 GCTCAGTTCTCATCTTGTTCTGG + Intronic
908420665 1:63955670-63955692 GCTAAGTTCTCTTCTGGTCCTGG - Intronic
909264139 1:73535269-73535291 GCTTTTTTCTCATCTGCAAATGG - Intergenic
923211398 1:231807217-231807239 TCACAGTCCTCATCTGGAACGGG + Intronic
1064157621 10:12916710-12916732 GCTCACATCTGATCTGGAACCGG + Intronic
1064983158 10:21184141-21184163 GCTTAGTTTTCATTTGGGCCAGG - Intergenic
1065073789 10:22055355-22055377 GCATAGTTTTCTTCAGGAACAGG + Intergenic
1066703674 10:38156461-38156483 GGGTATCTCTCATCTGGAACTGG - Intergenic
1066987056 10:42476491-42476513 GGGTATCTCTCATCTGGAACTGG + Intergenic
1069736868 10:70662234-70662256 GCTCAGCCCTCATCAGGAACTGG + Intergenic
1070295894 10:75161173-75161195 GCTCTGTTCTCATCTGGACACGG - Intronic
1070653591 10:78255394-78255416 GATGAGTTCTCACCAGGAACAGG + Intergenic
1072721376 10:97782938-97782960 TCTGAGTTCTCATCTGTAAATGG - Intergenic
1074502154 10:114035813-114035835 GTTTTGTTTTCATCTGTAACTGG - Intergenic
1074893820 10:117757581-117757603 GCTTTGCTTTCATCTGGAAGTGG + Intergenic
1078689595 11:13565739-13565761 GCTTCCTACTCTTCTGGAACTGG - Intergenic
1081677150 11:44976894-44976916 GCTTCCTTCTCAGCTGGAGCAGG - Intergenic
1085972589 11:81611529-81611551 CCCTAGTTCACATCTGGAAATGG + Intergenic
1088330103 11:108642514-108642536 CCTTAGTTCTCTCCTGGATCAGG - Intergenic
1088569656 11:111210717-111210739 GCTAAGTTTTCATCTGGTGCAGG - Intergenic
1090917284 11:131176852-131176874 GCTGAGGTCTGATCTGGAAGAGG + Intergenic
1094554798 12:31487925-31487947 GCTTAGTTCACCTCTTGATCTGG + Intronic
1095573707 12:43710527-43710549 GCTGAGTCCTAATGTGGAACTGG - Intergenic
1095714325 12:45325579-45325601 GCACTGTTCTCATCTGGAAGTGG - Intronic
1098818318 12:75196598-75196620 CCTTTTTTCTCATCTGGACCAGG - Intronic
1100010872 12:89951772-89951794 GCTTAGTTCTCCTTTGGAAATGG - Intergenic
1100486664 12:95035602-95035624 GGTTATTTCTCATCTGCCACTGG - Intronic
1106341378 13:28830820-28830842 GCTGACTTCTCATCAGAAACTGG + Intronic
1107759533 13:43662628-43662650 GATTAATTGTCATCTGGAAGGGG - Intronic
1110237356 13:73230598-73230620 GCCAAATTGTCATCTGGAACTGG - Intergenic
1114949095 14:27724692-27724714 TCTTATTTCTCATCTGGCAATGG - Intergenic
1115801954 14:37004669-37004691 GCTGAGGGCTCCTCTGGAACAGG + Intronic
1118674799 14:68172197-68172219 GCCTAGTTCTCATTTTGAAAAGG + Intronic
1124988468 15:34646548-34646570 TCTTAGTACTCATCTGGAAATGG + Intergenic
1126258138 15:46652504-46652526 CCTGAGTTCTCATTTGTAACAGG + Intergenic
1133995758 16:10746829-10746851 GCAAAGTTCTCTTCTGGAGCTGG + Intronic
1141452010 16:84110667-84110689 TCTCAGTTCTCATCTGAAAGTGG - Intronic
1145083367 17:19914288-19914310 GCTTATTTCTCAGCTGGACATGG - Intronic
1146567418 17:33925205-33925227 GCTCATTTCTCATCTGTAAGAGG + Intronic
1149594581 17:57856942-57856964 ACTTAGTTCTCTTCCTGAACTGG - Intergenic
1155736338 18:29226945-29226967 TCTTAGTTCTCTCCTGGATCAGG - Intergenic
1156848940 18:41703038-41703060 GATGAGTTCTGATCTGGAAATGG - Intergenic
1157337752 18:46754150-46754172 GGTTAGTCCTGATCTTGAACTGG - Intronic
1161076610 19:2288845-2288867 GCTCAGTTCACACCTGGGACAGG - Intronic
1163021324 19:14482442-14482464 GCTGAGTTCCCATCAGGCACTGG - Intronic
1164562749 19:29304104-29304126 GCTCAATTGTCATCTGGACCAGG - Intergenic
926339290 2:11891565-11891587 GGTGAGTCCTCATCTTGAACTGG + Intergenic
926384356 2:12321535-12321557 GACTAATTCTCATCAGGAACAGG - Intergenic
926730924 2:16034745-16034767 TGTGAGTTCTCATCTGGAAGGGG + Intergenic
930285484 2:49422679-49422701 TCTTAGTTATCTTCTGGATCAGG - Intergenic
931849678 2:66239724-66239746 TTTTAGTTCTTATTTGGAACTGG - Intergenic
938053938 2:128199316-128199338 GCTGACTTCCCATCAGGAACAGG + Intergenic
938555970 2:132424615-132424637 GCTATGGTTTCATCTGGAACTGG - Intronic
942698818 2:178679640-178679662 GGTTTCTTCTCTTCTGGAACAGG + Exonic
944963791 2:204906130-204906152 TCTTATTTCTCATCTGGACTGGG + Intronic
946519653 2:220450962-220450984 GCTGAGGTCTCCTCTGCAACTGG + Intergenic
1179372254 21:40817315-40817337 GCTTGTTTCTTCTCTGGAACAGG + Intronic
1182566419 22:31203360-31203382 TCCTAGTTCTCTTCTGGAAAAGG + Intronic
1184142397 22:42585487-42585509 GCTGATTTCTTATCTGGAAATGG - Exonic
1184822068 22:46917008-46917030 GCTTGGCTCTGATCTGGAATGGG - Intronic
952604695 3:35131013-35131035 GCTTATTTCTCCTGTGGCACTGG + Intergenic
952758500 3:36893176-36893198 CCTTAGTCCTCAGCAGGAACAGG - Intronic
956197542 3:66668198-66668220 GCTTGGTTCTAATCAGGATCAGG + Intergenic
957329509 3:78743464-78743486 GCTTAGTTCTCATGGAGAAGAGG - Intronic
960534702 3:118803044-118803066 CCTCAGCTCTCAGCTGGAACTGG - Intergenic
967264437 3:187677868-187677890 GCTTAATTCTAGTCTGAAACTGG + Intergenic
968111484 3:196051490-196051512 GCTTAGATCTCATTTGGAGAAGG + Exonic
970073302 4:12187933-12187955 AATTAGCTCTCATCTGGAAGTGG - Intergenic
970117427 4:12712719-12712741 GCTGCTTTCTCATCTGGAGCTGG - Intergenic
970966322 4:21932327-21932349 GAAAAGTTCTCAGCTGGAACAGG + Intronic
972706646 4:41551134-41551156 ACTTACTTCTCATCTTGAATGGG - Intronic
979679567 4:123444663-123444685 GCTCAGGCCTCATGTGGAACAGG + Intergenic
983601680 4:169536420-169536442 GCTTAGTTCTTGTCAGAAACAGG + Intronic
983809827 4:172047474-172047496 GCTTTGTTCTCAGGTGGAAAAGG - Intronic
994180933 5:96765284-96765306 GGTTTGTTCTCATCTGGGTCAGG - Exonic
997679886 5:135742869-135742891 GCAAAGTTCTCTTCTGGAGCTGG - Intergenic
998248095 5:140528314-140528336 GCTAACTTCTCATCTGGAGTAGG + Exonic
998809473 5:145951822-145951844 GCTTAGTTCTCCTATTGAACTGG + Intronic
1000291882 5:159878328-159878350 GCTTTGTTCCCATCTGGGGCAGG - Intergenic
1004767333 6:18745015-18745037 GCTGCATTCTCATCTGGAGCTGG - Intergenic
1009602334 6:65818124-65818146 GCATAGTTTCGATCTGGAACAGG - Intergenic
1011025563 6:82865613-82865635 ACTGAGTTCTCATTTGGAACAGG - Intergenic
1013736701 6:113235636-113235658 GCTTATTTCTACTCTAGAACTGG - Intergenic
1014221303 6:118801351-118801373 GCTTAGTACACATCAGGAAAGGG + Intergenic
1016214814 6:141585819-141585841 ACTTAGTTCTCATCTTAAAATGG + Intergenic
1020963370 7:14834387-14834409 GCTCAGTTCTCCCCTGGCACTGG + Intronic
1027792920 7:82656102-82656124 ACTGAGTTCTCTTCTGGAACTGG - Intergenic
1028706323 7:93851717-93851739 GCTGGGTACTCATCTGGAACTGG - Intronic
1029597202 7:101544148-101544170 GCTTTCTTCTCTACTGGAACAGG + Intronic
1031755752 7:125639726-125639748 GCTTAGTTCTCTTCTGCAGATGG - Intergenic
1033476538 7:141698475-141698497 ACTCAGTCCTCATCTGGAGCAGG - Intronic
1034906851 7:154956712-154956734 GCTTTGTCCTCATCAAGAACTGG + Intronic
1036932172 8:12966781-12966803 GCTCAGGTCCCATCTTGAACAGG - Intronic
1037686261 8:21142010-21142032 GCCTGCTTCTCATCTGGAATAGG - Intergenic
1039422190 8:37452474-37452496 TCTTATTACTCCTCTGGAACAGG + Intergenic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1051360062 9:16274164-16274186 GCTGTGTTCTCATCTAGAGCTGG - Intronic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1052067441 9:24039563-24039585 GTTTAGTCATCATTTGGAACAGG + Intergenic
1052268155 9:26597848-26597870 GCTAAGTCCTCAACTGCAACAGG + Intergenic
1054816916 9:69484338-69484360 GCTGAGTACCCATATGGAACAGG + Intronic
1061379244 9:130244172-130244194 GCTGTTTCCTCATCTGGAACTGG - Intergenic
1061882399 9:133574880-133574902 GCTTGGTCTTCATCTGGAAGGGG - Exonic
1062713072 9:137987254-137987276 CCTCAGTTCTCATCTGTATCTGG + Intronic
1189291968 X:39893045-39893067 GCTTGCTTCTCATCTGGGAGTGG - Intergenic
1193027466 X:76859922-76859944 GCTTATTTCTCATCTGAAACTGG + Intergenic
1194522097 X:94931671-94931693 GCTTAGTCCTCATCTAAAGCAGG + Intergenic
1195024354 X:100861342-100861364 GCTTAGTTCTCATCTGGAACAGG - Intronic