ID: 1195031183

View in Genome Browser
Species Human (GRCh38)
Location X:100929059-100929081
Sequence CAGGATGAAGAAAAGGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 601
Summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 537}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195031179_1195031183 21 Left 1195031179 X:100929015-100929037 CCGAATGCAGTGTTGAGGGACAG 0: 1
1: 0
2: 1
3: 14
4: 132
Right 1195031183 X:100929059-100929081 CAGGATGAAGAAAAGGCTGGAGG 0: 1
1: 0
2: 4
3: 59
4: 537
1195031175_1195031183 29 Left 1195031175 X:100929007-100929029 CCCTGTCTCCGAATGCAGTGTTG 0: 1
1: 0
2: 3
3: 6
4: 111
Right 1195031183 X:100929059-100929081 CAGGATGAAGAAAAGGCTGGAGG 0: 1
1: 0
2: 4
3: 59
4: 537
1195031176_1195031183 28 Left 1195031176 X:100929008-100929030 CCTGTCTCCGAATGCAGTGTTGA 0: 1
1: 0
2: 1
3: 11
4: 64
Right 1195031183 X:100929059-100929081 CAGGATGAAGAAAAGGCTGGAGG 0: 1
1: 0
2: 4
3: 59
4: 537

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195031183 Original CRISPR CAGGATGAAGAAAAGGCTGG AGG Intronic
901296619 1:8165821-8165843 CAGGAGGGAGAAAAGCGTGGGGG - Intergenic
901962797 1:12840790-12840812 CAGGATGGAGAAAAGACAGAAGG - Intergenic
901989988 1:13105093-13105115 CAGGATGGAGAAAAGACAGAAGG - Intergenic
902249632 1:15145751-15145773 GAGGATGCAGAAAGGGCAGGAGG + Intergenic
902330942 1:15731024-15731046 CAGGGTGAAGAAGGGCCTGGGGG - Intronic
902792168 1:18776859-18776881 CAGCATGGGGAAAAGGATGGAGG - Intergenic
903742861 1:25568421-25568443 CAGGATGGAAAAGATGCTGGAGG - Exonic
903766052 1:25735031-25735053 CAGCTTGAAGAAAGGGCTGGAGG + Intronic
903767600 1:25744598-25744620 TAGGAGGAAGATGAGGCTGGAGG - Intronic
904415747 1:30360167-30360189 CAGGTGGAGGAACAGGCTGGAGG - Intergenic
904833447 1:33320278-33320300 CAGGAGCAGGAAAAGGCTGGAGG + Intronic
904936031 1:34130366-34130388 CAGCAGGAAGAAATGTCTGGAGG + Intronic
905530979 1:38678500-38678522 CAGCATGAACAAAAGTCTGGGGG - Intergenic
905605780 1:39298073-39298095 GAGCATGAAGAAAAGGTTGAAGG + Intronic
906401912 1:45510609-45510631 AAAGAGGAAGACAAGGCTGGTGG - Exonic
906610445 1:47198266-47198288 CAGGATCAGGAAAATGGTGGGGG + Intergenic
907092622 1:51741977-51741999 CAACATGGAGAAAAGGCTTGAGG + Intronic
907766538 1:57417953-57417975 CTGGAGAAAGGAAAGGCTGGGGG - Intronic
908721040 1:67126255-67126277 CAGGAAGAGGAGCAGGCTGGAGG - Intronic
908843852 1:68304857-68304879 TAGGATGAAGATAATGGTGGAGG - Intergenic
908861280 1:68492631-68492653 CAGGAGGCAGAAAAGACTAGGGG + Intronic
909374393 1:74923686-74923708 CAGAATGAAGAAAAGCAGGGTGG + Intergenic
909388889 1:75094698-75094720 CAGGACAAAGAAAAAGCTGCAGG + Intergenic
909565977 1:77054058-77054080 CTGAATGAATAAAAGGCTTGTGG - Intronic
909591495 1:77353933-77353955 AAGGATGTACAAAAGGCTGCAGG + Intronic
909702564 1:78543601-78543623 CAGGAGGAAGAAAAAGAAGGGGG + Intergenic
910128516 1:83873823-83873845 CAGGAAGAGGAAAAGGAAGGTGG - Intronic
910216840 1:84851927-84851949 CTGGAGCAAGAAAATGCTGGAGG + Intronic
911204457 1:95078446-95078468 CAGGATAGAGAAGAGTCTGGAGG + Intergenic
911542864 1:99179459-99179481 CAGTAAGAACAAAAGGCTGTGGG + Intergenic
912142764 1:106751479-106751501 TAGGATGAAGTAAAGGCTTCTGG - Intergenic
913185709 1:116369099-116369121 AAGGATTAAGAAATGGCTCGGGG + Intergenic
915949847 1:160181877-160181899 GAGGGAGAAGAAAAGGCAGGGGG - Intronic
916888649 1:169095468-169095490 CAGGAAGTAGAGAAGGGTGGTGG + Intergenic
917336651 1:173930362-173930384 CATGAAGAAGAAAAGGGAGGAGG - Intergenic
917599860 1:176563175-176563197 AAGGATGAATAAAAGGGTGGAGG + Intronic
918809760 1:189100942-189100964 AAGGAAGGAGAAAAGGTTGGAGG + Intergenic
919595827 1:199561449-199561471 GAGGAAGAAGAACAGGCGGGGGG - Intergenic
919976091 1:202613792-202613814 CAGGAGGCAGCACAGGCTGGGGG + Intronic
920076175 1:203338563-203338585 AAGGTTTCAGAAAAGGCTGGTGG + Intergenic
920198804 1:204246646-204246668 CTGGGTGAAGAAAAGGCAGAGGG + Intronic
920440802 1:205979304-205979326 CAGGATGAAAAGGAGGTTGGGGG - Intronic
921546478 1:216480962-216480984 CACCATGAAGATAATGCTGGTGG - Intergenic
921734543 1:218612195-218612217 CAGGAAGAGGAAAAAGGTGGAGG - Intergenic
921811146 1:219515980-219516002 CAGGATGGACAAAATACTGGGGG - Intergenic
922471592 1:225880423-225880445 CAGGCTGAGGAGAAGGCAGGGGG + Intronic
922799258 1:228357218-228357240 AAGGATGAAGAAAAGGACAGTGG - Intronic
923863733 1:237917695-237917717 CAGGATCAACAACAGGCTGTGGG - Intergenic
924439541 1:244074731-244074753 CAGGAGAAAAAAAAGGCTGCAGG - Intergenic
924481171 1:244435634-244435656 GAGGAGGAAGAGAAGGATGGAGG - Intronic
924786369 1:247203633-247203655 CAGGATGAACAGCAGGCTGCTGG + Intergenic
1062974090 10:1670986-1671008 CAGAATCAGGAAAAGGCTTGAGG - Intronic
1063144180 10:3281469-3281491 AAGCCTGAAGGAAAGGCTGGGGG + Intergenic
1063499069 10:6536877-6536899 CAAGAGGAAGGAGAGGCTGGAGG + Intronic
1066092055 10:32032492-32032514 CAGGGTGAAAAAAAAGATGGCGG + Intronic
1066173567 10:32879145-32879167 AAGGATGAAGATAAGGTTGATGG - Intronic
1066200628 10:33140190-33140212 CAAGAAGAGGAAAAGGCCGGGGG - Intergenic
1068673958 10:59750858-59750880 CAGGATGCAGAAACGGGTGCAGG + Intergenic
1069622444 10:69846248-69846270 CTGGATGAAGAAGGGTCTGGTGG + Intronic
1070513794 10:77184925-77184947 CAGGAAGAAGAAAAAGCAAGAGG + Intronic
1071346472 10:84698684-84698706 TAGGATGCAGAAGAGGCAGGAGG + Intergenic
1071500405 10:86199649-86199671 CAGCATGAAGCAAGGGCTAGAGG + Intronic
1071867757 10:89755494-89755516 CAGGATGAAGAAAAGGAAGAAGG - Intronic
1073298776 10:102457907-102457929 CTGGAGGTAGAAAATGCTGGAGG + Intergenic
1073299770 10:102463880-102463902 CAGCATGAACAAAAGTGTGGAGG + Intronic
1073462093 10:103671687-103671709 CAGGAGGCAGACAAGGCTGTTGG + Intronic
1073754204 10:106563608-106563630 GAAGATAAAGAAAAAGCTGGAGG + Intergenic
1076529832 10:131136797-131136819 CAGGAAGTAGAAATGCCTGGAGG - Intronic
1076758106 10:132585702-132585724 AAGGATGAAGAAAGAGATGGTGG - Intronic
1077840430 11:5968375-5968397 CAGGAGGAAGAGGAGGCTGAGGG + Exonic
1077843810 11:6002873-6002895 CAGGAGGAAGAGAAGGCTGAGGG + Exonic
1077846240 11:6027573-6027595 CAGGAGGAAGAGAAGGCTGAGGG + Exonic
1078430157 11:11282116-11282138 CAGGAGGAAGACAGTGCTGGTGG - Intronic
1078757489 11:14224690-14224712 GAGGATGAAGATGAGGATGGTGG + Intronic
1078759217 11:14238336-14238358 TAGGATGAGGAAATGGCTTGTGG + Intronic
1079093729 11:17497778-17497800 CAGGATGAAGGAGGGGCTGGTGG - Intronic
1079899001 11:26157544-26157566 CAGGAGAGAGAAAAGACTGGAGG + Intergenic
1080075163 11:28139842-28139864 CAGGATGGAGAAAATGCCTGAGG + Intronic
1081060594 11:38470573-38470595 GAGGATGAAGAAAAAGGAGGAGG - Intergenic
1082199025 11:49340438-49340460 AAGGAAGAAGACTAGGCTGGAGG + Intergenic
1082857480 11:57821412-57821434 ATGGATGAAGAGAAAGCTGGAGG + Intergenic
1083488845 11:63000181-63000203 CTGGAAGAAGGGAAGGCTGGAGG + Intronic
1083694309 11:64432434-64432456 CAGGAGGCAGCAAGGGCTGGTGG - Intergenic
1083748564 11:64748262-64748284 CAGGATGGAGACAGTGCTGGAGG - Intronic
1083967284 11:66050680-66050702 CAGGATAAACTAAAGGCTGATGG - Intergenic
1084225151 11:67711066-67711088 CAGGAGGGAGGAAGGGCTGGTGG + Intergenic
1084262971 11:67990909-67990931 CAGGAGGGAGGAAGGGCTGGTGG + Intergenic
1084366551 11:68705017-68705039 CAGGATGGAGGCAGGGCTGGGGG + Intergenic
1084470413 11:69356174-69356196 GAGGATGAAGAGAAGGAAGGAGG + Intronic
1084539840 11:69779158-69779180 CAGGAGGATGATAAGGCCGGTGG + Intergenic
1084787832 11:71453604-71453626 CACGGTTAAGAAAAGTCTGGCGG + Intronic
1084810422 11:71608207-71608229 CAGGAGGGAGGAAGGGCTGGTGG - Intergenic
1085037106 11:73307471-73307493 GAGCAAGAAGAAAAGGCTCGGGG + Intergenic
1085750458 11:79156484-79156506 CAGCATGTAGAAAGTGCTGGAGG - Intronic
1085849519 11:80103440-80103462 AAGGTTGAAGAAAAGGAAGGGGG - Intergenic
1086123649 11:83327420-83327442 CAAGATCAAGAAAAGCCTTGTGG + Intergenic
1086656788 11:89367649-89367671 AAGGAAGAAGACTAGGCTGGAGG - Intronic
1086902877 11:92387411-92387433 CAGGGTGAAGGAAAAGGTGGTGG + Intronic
1087268124 11:96083159-96083181 CAGGATAAAGAACACACTGGAGG - Intronic
1089048624 11:115526353-115526375 AAAGATGATGAAGAGGCTGGAGG - Intergenic
1089492680 11:118893714-118893736 CAGGAGGAAGATGAGGCTGTAGG - Exonic
1090040807 11:123289633-123289655 CAGGAGGAAGCAAGGGGTGGGGG + Intergenic
1090866132 11:130702309-130702331 CAGGGTAGGGAAAAGGCTGGGGG + Intronic
1090941610 11:131392607-131392629 CAGGTTGAAGAGAGGGCAGGAGG + Intronic
1091461823 12:648864-648886 CAGTGTGAACAAAAAGCTGGAGG - Intronic
1091790087 12:3267152-3267174 CAGGATGGCGAAGGGGCTGGGGG - Intronic
1092302097 12:7261158-7261180 CAGGATAGAGCAAAGGCTGTAGG + Intergenic
1092674151 12:10897695-10897717 CAGGAGGAAGAGAAAGATGGGGG + Intronic
1092956430 12:13554804-13554826 CAGGATGAAGAAAATGGAGGAGG + Exonic
1093584046 12:20816767-20816789 CACTATGAAGAACAGTCTGGAGG - Intronic
1095354320 12:41253561-41253583 CAATATGAAGAACAGGATGGAGG + Intronic
1096616266 12:52834979-52835001 CAGGAGGTAGAAAAGGCCTGGGG + Intergenic
1097090205 12:56498790-56498812 CAGGATCAACAACAGGCTGTGGG + Intergenic
1098654047 12:73006751-73006773 AAGGATGAAGAAGGGGTTGGGGG + Intergenic
1098909273 12:76192662-76192684 CAAAACGAACAAAAGGCTGGAGG - Intergenic
1099087286 12:78261265-78261287 AGGGATAAAGAAAAGGGTGGGGG + Intergenic
1099428307 12:82551146-82551168 CAGGAAGCACAAAAGGGTGGGGG - Intergenic
1100690269 12:97032112-97032134 CAGGAGGAAGAACAGGTTTGAGG + Intergenic
1100921524 12:99493704-99493726 CAGCATGAAGAAAAGGTTTGGGG + Intronic
1101042707 12:100772721-100772743 CAGGAAGAATGAAAGGCTGAAGG - Intronic
1101418750 12:104531730-104531752 CAGGATGGAGAAGAGGCAGGAGG - Intronic
1101679225 12:106948632-106948654 ACAGATGAAGAAAAGGCTGAGGG - Intergenic
1101847355 12:108373193-108373215 GGGGATGAAAAAAAGGATGGAGG + Intergenic
1101889895 12:108703844-108703866 CAGGAGGAACAAGGGGCTGGAGG - Intronic
1102689893 12:114752084-114752106 CAGGATGGGGAAAGGGCGGGGGG - Intergenic
1103177996 12:118881138-118881160 CAGAAAGAAGAAAGAGCTGGGGG - Intergenic
1104644020 12:130484460-130484482 CAGGAGGAAAATAAGGCAGGTGG - Intronic
1104648603 12:130514643-130514665 CAGGCTGACGACAGGGCTGGTGG - Intronic
1104834815 12:131782150-131782172 CAAGAAGAAGAAGAAGCTGGTGG + Intronic
1105306345 13:19171739-19171761 CAGGACAAAGGAAAAGCTGGGGG + Intergenic
1106217826 13:27719107-27719129 GAGGATGAAGAAACTGGTGGAGG + Intergenic
1106509954 13:30404243-30404265 CAGGAAGCAGAAAAGACTGCGGG - Intergenic
1106924168 13:34595702-34595724 CAGGATGAAGGAACCCCTGGAGG + Intergenic
1107275084 13:38669103-38669125 CAGGAAGCAGAAAAGCCGGGGGG + Intergenic
1108041718 13:46345503-46345525 CAGGATCAAGAAAGGGCTGCTGG - Exonic
1110284389 13:73732643-73732665 CAGAAAGGAGAAACGGCTGGAGG - Intronic
1110731942 13:78888682-78888704 TAGGATGAAGGAAAGGCGGAGGG + Intergenic
1111680004 13:91430598-91430620 CAGGATGAAGCAAAATCTGTGGG + Intronic
1111780659 13:92719460-92719482 CAGGATGAAATAAATGCTGAAGG - Intronic
1112911229 13:104486568-104486590 CAGGTTGAAGAAAAGACTATTGG - Intergenic
1112911683 13:104493242-104493264 CAGGATGAAAAAAATGTTGATGG - Intergenic
1113017313 13:105841688-105841710 CAGGGTGAAGAACACCCTGGAGG + Intergenic
1113473915 13:110566349-110566371 CTAGATGAAGAAAAGGGAGGAGG + Intergenic
1114487243 14:23070179-23070201 CAGCATGGAGAAAATGGTGGGGG + Intronic
1114837400 14:26219345-26219367 GAGGAAGAAGAAAATGATGGTGG + Intergenic
1114889564 14:26901076-26901098 AAGGAGGAAGAAAAGAGTGGAGG - Intergenic
1114957069 14:27835761-27835783 CAGAAAGAAAAAAAGGCGGGGGG - Intergenic
1115251162 14:31349430-31349452 CAGGAAAAAGAAAAGGCTGTAGG - Intronic
1116581092 14:46642383-46642405 CAAGATGTAGCAAGGGCTGGAGG + Intergenic
1117343670 14:54812624-54812646 CAGGATGAAGGAAGGGAAGGAGG - Intergenic
1117707196 14:58482535-58482557 CAGCATCAACAAAAAGCTGGAGG - Exonic
1118729911 14:68658985-68659007 CGGGAGGGAGGAAAGGCTGGCGG + Intronic
1118975619 14:70673647-70673669 AAGGATGAAGAGAAGGGTAGAGG + Exonic
1119012213 14:71005027-71005049 CAGAATGAAGGGAAGGTTGGGGG + Intronic
1119611285 14:76064844-76064866 CAGGGTGGAGAAAAGCCTGGAGG - Intronic
1119783461 14:77295128-77295150 CAGGATGCTGAAGAGGTTGGTGG - Intronic
1120714574 14:87826825-87826847 CAGGATGAAAAAAATGCAGCAGG - Intergenic
1121666734 14:95677911-95677933 CAGGCAGGAGAAAGGGCTGGAGG + Intergenic
1122330669 14:100910380-100910402 TAGGAGGGAGGAAAGGCTGGTGG + Intergenic
1122395040 14:101420227-101420249 AAGGCTGAAGAGAAGACTGGAGG + Intergenic
1122805671 14:104255360-104255382 CAATAGGAAAAAAAGGCTGGAGG - Intergenic
1122810458 14:104285168-104285190 AAGGATGAAGGAAAAGCCGGTGG + Intergenic
1123878973 15:24656774-24656796 CAGGCTGAAGAAGAGGTGGGCGG + Intergenic
1123963361 15:25430858-25430880 TAGGCTGAATGAAAGGCTGGGGG - Intronic
1124807441 15:32899650-32899672 CAGGATCCTGCAAAGGCTGGAGG - Intronic
1124988741 15:34649812-34649834 CAGGAAGAAGGAAAGACTGTGGG - Intergenic
1125180176 15:36873629-36873651 CAGAATCAAGATAAAGCTGGGGG + Intergenic
1125301788 15:38262520-38262542 CAGAAAGAAGAAAAAGTTGGAGG + Intronic
1125547278 15:40515290-40515312 AAGGAGGAAGAAAAGGAGGGTGG - Intergenic
1125834170 15:42736192-42736214 CAGGATGGGTAGAAGGCTGGGGG - Intronic
1127594596 15:60466454-60466476 CATGATGAAGAAAAGACCTGTGG + Intronic
1128225874 15:66000965-66000987 CAGCATGGGCAAAAGGCTGGAGG + Intronic
1128463366 15:67888276-67888298 CAGAATGAGCAAAAGCCTGGAGG + Intergenic
1128468734 15:67934286-67934308 CAGGAAGAAGAAAAAGACGGGGG + Intergenic
1128941370 15:71790482-71790504 CTGGATGAAGAACAGGCAAGAGG + Intergenic
1130061359 15:80572446-80572468 TAGGATGAGGAAGTGGCTGGTGG - Intronic
1132608215 16:802246-802268 CAGGATGCAGGCAAGGCGGGGGG + Intergenic
1132967683 16:2668046-2668068 CAGGATCAACAACAGGCTGTGGG + Intergenic
1134209314 16:12262481-12262503 TGGGATCAATAAAAGGCTGGTGG + Intronic
1134835735 16:17359033-17359055 CAGGAGGAGGAAAAGACTGATGG + Intronic
1135426496 16:22341360-22341382 CAGGAAAAATAAAAGGCTGGTGG + Intergenic
1135960356 16:26989904-26989926 CAGGGTGAGGAAAAGGAGGGCGG - Intergenic
1135984145 16:27171393-27171415 CAGGATGTACAAAGGCCTGGAGG + Intergenic
1136374103 16:29854908-29854930 CAGGAAGGAGAAAGGGCTGCAGG + Intergenic
1136394862 16:29987310-29987332 CAGGAGTAGGAAAAGACTGGAGG - Exonic
1136932502 16:34432026-34432048 CAGGATGAAGAAACTTCAGGCGG + Intergenic
1136972070 16:34979788-34979810 CAGGATGAAGAAACTTCAGGCGG - Intergenic
1137438760 16:48480944-48480966 CAGAACAAAGAAAAGGTTGGGGG - Intergenic
1138735657 16:59247641-59247663 CAGCATAAAGAAAAGCCTAGAGG + Intergenic
1138991276 16:62393118-62393140 CAGCACGAAGAAGAGTCTGGGGG - Intergenic
1138995581 16:62448608-62448630 CTGGAGGAAGAAAAAGATGGAGG + Intergenic
1139201644 16:64983690-64983712 CAGGATGATGGAAAGGCTGGGGG - Intronic
1139268847 16:65663582-65663604 CAGGAAGGAGCAAAGGCTGTTGG - Intergenic
1140246185 16:73252260-73252282 CTGGAAGAAGAAAAGACTTGAGG + Intergenic
1140265621 16:73418011-73418033 AAGGAAAAAGAAAAGGCTGTGGG + Intergenic
1140906242 16:79411734-79411756 CAGCAAGAGGAAAAGCCTGGGGG - Intergenic
1141233918 16:82197757-82197779 CAGGATGTGGGAAAGCCTGGGGG + Intergenic
1141245455 16:82302738-82302760 CCTGATGAAGAAAAGATTGGAGG - Intergenic
1141268795 16:82520663-82520685 CTGGATTAAGAATAGGCAGGAGG - Intergenic
1141590259 16:85063739-85063761 AAGAATGTAGAAATGGCTGGCGG - Intronic
1142024848 16:87806961-87806983 CTGGATGAAAAAGAGGCTGGTGG - Intergenic
1142394635 16:89825056-89825078 CAGGATGCAGCAGTGGCTGGAGG + Intronic
1142808345 17:2383462-2383484 CAAGGGGAAGAAGAGGCTGGAGG - Intergenic
1142854943 17:2724237-2724259 CGGGAAGTACAAAAGGCTGGCGG + Intergenic
1143272407 17:5685524-5685546 CATGGTGAAGAGGAGGCTGGAGG + Intergenic
1143274636 17:5701085-5701107 CAGGATAAAGCCAAGTCTGGGGG - Intergenic
1143524224 17:7463006-7463028 GAGGAGGAATCAAAGGCTGGTGG - Exonic
1143585401 17:7848107-7848129 CAGGAGGAAGGAGGGGCTGGAGG - Exonic
1145305703 17:21673988-21674010 CAGGAGGAAGAAACTGCGGGCGG - Intergenic
1146785860 17:35720776-35720798 CAGGATGAAGAATAGGAAAGAGG - Intronic
1148058702 17:44819137-44819159 CAAGATGAAAAAAATTCTGGAGG - Intronic
1148240724 17:45997986-45998008 AAGGGTGAAGAGGAGGCTGGGGG + Intronic
1148805517 17:50261970-50261992 CAGACAGAAGGAAAGGCTGGGGG - Intergenic
1148878966 17:50710712-50710734 AAGGATGAAGAGAAGGTTTGAGG + Intergenic
1148909043 17:50930514-50930536 AAAGAAAAAGAAAAGGCTGGGGG - Intergenic
1149047510 17:52265048-52265070 CAGGTAGAGGAAAAGTCTGGAGG + Intergenic
1149774967 17:59349958-59349980 CAGGATCAAGAAAGGCCTGTAGG - Intronic
1150202097 17:63368258-63368280 CAGGAGGAAGAACAGGCTTATGG + Intronic
1150213042 17:63452059-63452081 CAGCATGAAGAAGAGGCAGAAGG + Intergenic
1150473304 17:65455911-65455933 CATGATGAAGGAAAGGATGGAGG + Intergenic
1151164632 17:72193170-72193192 CTGGCTGGAGAAGAGGCTGGAGG - Intergenic
1151343882 17:73489594-73489616 CTGGATGTTGATAAGGCTGGAGG + Intronic
1151898036 17:76993540-76993562 AAGGATGAAGGAAAGTCAGGGGG - Intergenic
1154066859 18:11114796-11114818 CAAGAGTAAGATAAGGCTGGAGG + Intronic
1154085369 18:11299935-11299957 CAGTATGAAGAACAGTTTGGAGG - Intergenic
1155071774 18:22323149-22323171 CAGGAGGAGGAGAGGGCTGGGGG + Intergenic
1155264356 18:24076528-24076550 CAGGAGGAGGCAGAGGCTGGGGG - Intronic
1155912599 18:31521870-31521892 CAAGATGAAGGCAAGGCTGAGGG - Intronic
1156851821 18:41737543-41737565 AAAGATGAAGAAAAGGAGGGTGG - Intergenic
1157292170 18:46417596-46417618 CAGGAAGAAGAAAAGGTTGGGGG - Intronic
1157430059 18:47617263-47617285 GAGGATGAGGGAAAGCCTGGAGG + Intergenic
1157523960 18:48364473-48364495 CAGAATTAAGCAAAGGCTTGTGG + Intronic
1157731934 18:50011542-50011564 CAGGATGAGGAACAGATTGGTGG - Intronic
1158152197 18:54386211-54386233 CAGGATGTAGAACAAGATGGAGG + Intergenic
1158507044 18:58056165-58056187 CAGAATTATTAAAAGGCTGGGGG - Intronic
1160304481 18:77718776-77718798 AAGGAGGTAGAAAAAGCTGGAGG - Intergenic
1160753826 19:747646-747668 CAGGATGGAGAAGAGGCCGGGGG - Exonic
1160779012 19:869592-869614 CACGAGGAAGAAAATGCTGGAGG + Intronic
1160827676 19:1088382-1088404 CAGGAGGAAGCAGTGGCTGGTGG + Exonic
1162567305 19:11451577-11451599 CAGGATGAAGGGAGGGGTGGAGG + Exonic
1162601748 19:11675007-11675029 CAGGATCAGGAAAAGGCAGAGGG - Intergenic
1162850640 19:13428737-13428759 CAGGTTGAAGGAAACACTGGTGG - Intronic
1163947750 19:20555613-20555635 GAGAATGAAGAAAAGGCTCTGGG + Intronic
1163974714 19:20840056-20840078 CAGGATTAAGAAAATGCTTGTGG - Intronic
1164084373 19:21888028-21888050 CAGGATCAACAACAGGCTGTGGG + Intergenic
1164236932 19:23345690-23345712 GAAGATAAAGAAAAGGCTTGGGG - Intronic
1164397390 19:27877973-27877995 TAGGATGAAGAAAACAGTGGGGG - Intergenic
1165154241 19:33777654-33777676 CAGGGTGAAGGAGAGGCAGGAGG - Intergenic
1165259996 19:34605436-34605458 CGGAATGAAGAACAAGCTGGTGG - Intronic
1165390235 19:35534521-35534543 CCGGTTGGAGAAAAGCCTGGGGG - Intronic
1165478982 19:36050539-36050561 CAGGATGGAGAAATGTCTTGAGG + Intronic
1165595353 19:37008004-37008026 CAGGATGAAGAAACCACAGGCGG + Intronic
1165600979 19:37055799-37055821 CAGGATGAAGAAACAGCAGGCGG + Intronic
1166360143 19:42249606-42249628 GAAGATGAAGAGCAGGCTGGTGG + Exonic
1166768517 19:45266381-45266403 CAGGAGGAGAAAAGGGCTGGAGG - Intronic
1167330034 19:48849804-48849826 CAAGATGGAAAAAAGGCTGAGGG + Intronic
1167576906 19:50322161-50322183 TAGGAGGAAGGAGAGGCTGGTGG - Intronic
1168217327 19:54935943-54935965 CGCGGTGCAGAAAAGGCTGGGGG + Intronic
1168282640 19:55313614-55313636 AAGGATGAAGAGAGGGCCGGGGG - Intronic
925072595 2:982967-982989 CAGGATGAAGCAGAAGCTGCAGG + Intronic
925323976 2:3001480-3001502 CAGGAGGAAGAAAAAGCAGTGGG + Intergenic
925938615 2:8793043-8793065 AAGCATAAAGAAAAGCCTGGAGG + Intronic
926388384 2:12361304-12361326 CAGGACAAATAAAAGGCTGAAGG + Intergenic
927070099 2:19519446-19519468 TAGCATGAAGAAAAAGATGGCGG - Intergenic
927855556 2:26525460-26525482 CAGGATGAGGAACAGGCTGCTGG - Intronic
929558465 2:42940302-42940324 GAGGATGAAGATGAGGATGGCGG + Intergenic
929561613 2:42959888-42959910 CAGAAAAAAGAAAAGGCTGGGGG - Intergenic
930047907 2:47189623-47189645 GAGGAGGAAGAAAAGACTGGAGG - Intergenic
931458816 2:62433008-62433030 CAGGAGGAAGAAAAGCCTCGTGG - Intergenic
931852260 2:66263558-66263580 GGGCATGAAGAAAAGGATGGTGG - Intergenic
932041170 2:68301530-68301552 CAAGAGGAAGAAAAGGGCGGTGG + Intronic
932439243 2:71721372-71721394 CAAGAAGAAGAAAAAGCTGAAGG + Intergenic
933131318 2:78677127-78677149 CAGGATGTAGAACAAGATGGAGG + Intergenic
933180633 2:79222650-79222672 CAGGAAGAAAAGAAGGCAGGAGG - Intronic
933188651 2:79307788-79307810 CATGATGAAGAACAGTATGGAGG - Intronic
933306775 2:80610242-80610264 GAGCATGAAGAAAAAGATGGAGG - Intronic
933897129 2:86821831-86821853 CAGGGGGAAGAGAAGGGTGGAGG - Intronic
935254642 2:101298784-101298806 CGGGATGCAGGACAGGCTGGGGG + Intronic
935370459 2:102340922-102340944 CAGGAGGAAGTAAAGGGAGGAGG - Intronic
935706872 2:105864528-105864550 TAGGATGCAGAGAAGGCTGCAGG + Intronic
936961945 2:118085314-118085336 CAGGATGAAGAACAGGTGTGAGG - Intergenic
938305220 2:130248673-130248695 CATGATGAAGAAAAGGGTGCCGG - Intergenic
938448797 2:131398534-131398556 CATGATGAAGAAAAAGGTGCTGG + Intergenic
938458933 2:131485219-131485241 CAGGACAAAGGAAATGCTGGGGG - Intronic
939195948 2:138972394-138972416 CAGGGTGGAGAGAAGGCAGGAGG + Intergenic
940007220 2:149019101-149019123 CAGAATGCAGAAACAGCTGGGGG - Intronic
941318690 2:164027324-164027346 CAGGATGAAGAAAAGGAGGATGG + Intergenic
941932652 2:170957574-170957596 AGGGATGAAGAAAAGGAAGGAGG - Intronic
942216694 2:173727916-173727938 CAGCAAGAGGAAAAGGCAGGTGG + Intergenic
943127420 2:183811945-183811967 CAGAATGATGAAAAAGCTGTTGG + Intergenic
943278251 2:185896810-185896832 CAAGAAGAAGAAAAGGGAGGGGG + Intergenic
944015211 2:195027653-195027675 CAGAATGAAGAGAAAGTTGGTGG + Intergenic
944964120 2:204910157-204910179 CAGGATGAAGAGAAAGCAGTTGG + Intronic
946394471 2:219436195-219436217 CAGTGTGAAGAAAAGGCTGAGGG + Intronic
946745785 2:222844323-222844345 ATAGATGGAGAAAAGGCTGGGGG - Intergenic
946866297 2:224043972-224043994 CAGGAGGAAGAACTGGTTGGGGG - Intergenic
948299786 2:236895398-236895420 CAGGCAGAAGAAAAGGCTCATGG + Intergenic
1168940796 20:1709423-1709445 CAGGATGAAGAAAATCCCAGAGG - Intergenic
1169065021 20:2690280-2690302 CAGGAAGAAGAGCTGGCTGGTGG + Intergenic
1169293682 20:4374506-4374528 AAGGAGTAAGAAAAGGTTGGAGG - Intergenic
1169638360 20:7720381-7720403 CAGGATGAAGAGCATCCTGGGGG + Intergenic
1170143029 20:13143932-13143954 CAGGATGAGGGAAAAGCTGGAGG - Intronic
1170373005 20:15669825-15669847 CAGGTGGGAGAATAGGCTGGGGG + Intronic
1170539575 20:17374482-17374504 AAAGGTGAAGAAAAGGCTGGTGG + Intronic
1170556780 20:17521338-17521360 CAGCATGAAGAAATGCATGGTGG + Intronic
1170977359 20:21178017-21178039 GAGAAAGAAGAAAAAGCTGGAGG - Intronic
1171076475 20:22131486-22131508 CTTGATCAAGAAAAAGCTGGAGG + Intergenic
1171523215 20:25791476-25791498 CAGGAGGAAGAAACTGCAGGTGG - Intronic
1171530958 20:25853456-25853478 CAGGAGGAAGAAACTGCAGGTGG - Intronic
1171553611 20:26064407-26064429 CAGGAGGAAGAAACTGCAGGTGG + Intergenic
1171724620 20:28604425-28604447 CAAGATGGAAAAAAGGCCGGTGG + Intergenic
1172574299 20:35995402-35995424 CTGGGTGAAAAAAAGGGTGGGGG - Intronic
1172834681 20:37865463-37865485 CAAGATGAAAAAAAGGCCTGTGG - Intronic
1173465340 20:43276446-43276468 CAGGATGGAGAACAGATTGGAGG + Intergenic
1173584781 20:44174396-44174418 CAGGATGCAAAAAGGGTTGGGGG - Intronic
1173705158 20:45104799-45104821 CAGGGTAAAGAAAGGGCAGGAGG - Intergenic
1173753679 20:45496554-45496576 CAGAATGCAGAAGAGGCAGGGGG + Intergenic
1174466288 20:50720133-50720155 GAGGAAGAAGAAAAGTCTGAAGG - Intergenic
1175318254 20:58067229-58067251 CATGTTGAAGGAAGGGCTGGAGG + Intergenic
1175648532 20:60696503-60696525 TGGGATAAAGAAAAGGCAGGAGG - Intergenic
1176139330 20:63538173-63538195 CAGGAGGAGGCAGAGGCTGGAGG - Intergenic
1177614622 21:23500790-23500812 CAGGAGGAAGAGAGGTCTGGGGG - Intergenic
1179238456 21:39567659-39567681 CAGGAAGAAGGAGAGGATGGTGG - Intronic
1180142214 21:45899535-45899557 CAGGAGGAGGAAAACACTGGAGG - Intronic
1180246673 21:46553053-46553075 GGGGATGCAGATAAGGCTGGGGG + Intronic
1181824874 22:25507032-25507054 ATGGATGAATAAAAGGATGGGGG - Intergenic
1181824895 22:25507153-25507175 ATGGATGAATAAAAGGATGGAGG - Intergenic
1182048801 22:27297752-27297774 ATGGATGCAGAAATGGCTGGGGG - Intergenic
1182700860 22:32237044-32237066 CAGCATGAGGAAATGGATGGTGG - Intronic
1183228550 22:36566459-36566481 CAGGATTGGGAAAATGCTGGAGG + Exonic
1183239493 22:36646725-36646747 CAGGGGGAAGAAAAGGGTTGGGG - Intronic
1183272115 22:36868678-36868700 AAGGAGGAAGAGAAGGCAGGAGG + Intronic
1183466943 22:37984642-37984664 GGGGATGAAGGAAAGCCTGGAGG - Intronic
1183850493 22:40582878-40582900 CTGTATGAAAAAAAGGCTGATGG + Intronic
1183876206 22:40784240-40784262 CATGATGAATAAATGGCTTGTGG + Intronic
1185068716 22:48644755-48644777 CAGGCTGTAGAAACGGCTGCTGG + Intronic
1185167105 22:49268211-49268233 CAGAATGAACAAGATGCTGGGGG - Intergenic
949461107 3:4295426-4295448 CTGCAAGCAGAAAAGGCTGGTGG + Intronic
949751044 3:7353143-7353165 CTGGAAGCAAAAAAGGCTGGTGG - Intronic
950480166 3:13238996-13239018 CAGGAATGAGGAAAGGCTGGTGG - Intergenic
950647258 3:14384557-14384579 CAGGAGGAAGGAGAGGATGGGGG - Intergenic
951501496 3:23392514-23392536 CAGGAAGAAGAAGAGGGAGGGGG + Intronic
951912584 3:27767214-27767236 CAGAAGGAAGAAGAGGCTTGAGG - Intergenic
951955666 3:28250539-28250561 CAGAAAGAAGAAAAGGGTGGTGG - Intronic
951996646 3:28736863-28736885 GAGGATGAAGAAAAGCATGGTGG - Intergenic
952447705 3:33398660-33398682 CAGGATAAGGAAAAGGCAGAAGG + Intronic
952845904 3:37688012-37688034 CAGGATGAGGAAGCTGCTGGAGG + Intronic
953256621 3:41296916-41296938 CAGGAAGAAGAGAGGGATGGAGG + Intronic
953404198 3:42652571-42652593 CAAGCTGCAGAAAGGGCTGGAGG - Intergenic
954112401 3:48441813-48441835 CATGATGGAGACAAGGATGGTGG + Intronic
954905268 3:54056907-54056929 GAGGATTAAGGAAGGGCTGGTGG - Intergenic
955249432 3:57263959-57263981 CACTATGGAGAAAAGTCTGGAGG - Intronic
955625240 3:60911418-60911440 CATGATGATGAAAATGATGGTGG - Intronic
955803387 3:62708815-62708837 CAGGATAAAGAAAGGGGTAGGGG + Intronic
955990546 3:64622377-64622399 CAAGCAGAAGAAAAGGGTGGTGG + Intronic
956815776 3:72906989-72907011 CAGGAGAAAGCATAGGCTGGGGG + Intronic
957078403 3:75618851-75618873 CAGGAGGGAGGACAGGCTGGTGG + Intergenic
957212086 3:77272399-77272421 CAGGAGGAAGAGAAGGGCGGGGG + Intronic
957786975 3:84895817-84895839 CATTATGAAGAAAAGTTTGGAGG - Intergenic
958879062 3:99648946-99648968 CAGGATAAAGGAAGGGCTTGAGG - Intronic
959144878 3:102532692-102532714 CAGAAATAAGAAAAGCCTGGAGG + Intergenic
959612278 3:108308582-108308604 CAGTATGAAGAAAAGTTTGGAGG - Intronic
959790603 3:110356834-110356856 CAGGAAGAATAAAAGGAAGGAGG - Intergenic
959792218 3:110375558-110375580 CAGGATGACGAGAAGACTTGGGG + Intergenic
962057687 3:131889492-131889514 CAGGTTGAATGAAAGCCTGGTGG + Intronic
962989190 3:140563151-140563173 CAGGATGATGGACAGACTGGAGG - Exonic
964622947 3:158733694-158733716 CAGGATGGAGAAATGGATGTTGG - Intronic
964653288 3:159036372-159036394 GTGGAGGAAGAAAAGGCAGGTGG - Intronic
966948713 3:184796605-184796627 CAGGATGAAAAGAGGGCCGGCGG + Intergenic
968267123 3:197370889-197370911 CAGGATGAAGCAAGGGTAGGGGG - Intergenic
968812923 4:2808258-2808280 AAGGATGGAAAAGAGGCTGGAGG - Intronic
969021480 4:4142825-4142847 CAGGAGGGAGGAAGGGCTGGAGG + Intergenic
969428967 4:7142110-7142132 GAGGATGAAGATGAGGCAGGTGG - Intergenic
969732386 4:8964592-8964614 CAGGAGGGAGGAAGGGCTGGTGG - Intergenic
969791967 4:9498675-9498697 CAGGAGGGAGGAAGGGCTGGTGG - Intergenic
970003174 4:11384775-11384797 AATGAAGAAGAAAAGGCTGATGG - Intergenic
970946929 4:21705197-21705219 AAGGATTAAGCAAAGGGTGGGGG + Intronic
971454774 4:26834088-26834110 CAGGAGGAAGAGAAGGAAGGGGG - Intergenic
971508864 4:27399188-27399210 CAGGAAGAAATGAAGGCTGGAGG + Intergenic
971748987 4:30622052-30622074 CAGCATGAACAAAGGGCTGTGGG - Intergenic
971895312 4:32585547-32585569 TAGTATGAAGAAAAGTCTGGAGG + Intergenic
972351020 4:38236336-38236358 AAGCATGCAGAAAAAGCTGGAGG - Intergenic
972653584 4:41044266-41044288 CAGTATGAAGAAAAGGTTAATGG - Intronic
972736423 4:41846102-41846124 CAGGAGGAAGAGAAGGAAGGGGG - Intergenic
972840200 4:42921870-42921892 GAGGATGAGGAAAAGGAAGGTGG - Intronic
973571363 4:52242985-52243007 CTGGATGAAGCAAATGCTGTGGG + Intergenic
974196738 4:58585165-58585187 CTGGGGGAAGAAATGGCTGGGGG - Intergenic
975245578 4:72117073-72117095 AAGGAAAAAGAAAAGGGTGGGGG - Intronic
975945211 4:79697201-79697223 GAGGCTGAAGAAAAGACAGGGGG - Intergenic
977139129 4:93344776-93344798 CAGGAGCTAGAGAAGGCTGGCGG - Intronic
977957856 4:103051104-103051126 GAGGATGAAGAAACGGCTAGGGG + Intronic
980128913 4:128800489-128800511 TTGGAGGAAGATAAGGCTGGAGG + Intergenic
980999377 4:139813721-139813743 CAAGGTGAAGCAAAGGCTCGGGG + Intronic
981150766 4:141377206-141377228 CAGCATGAACAAAAAGCTGTGGG + Intergenic
982242183 4:153311420-153311442 CAGGATAGACAAAAGGCTAGAGG + Intronic
982463603 4:155702585-155702607 CAGGATGAAAGAAAAGCTGGTGG - Intronic
983525411 4:168755666-168755688 CTGCATGAAGAATAGTCTGGAGG + Intronic
983756538 4:171344819-171344841 CAGGATGAGTAAAATTCTGGAGG - Intergenic
983850114 4:172569965-172569987 CAGGAGGAAGGAGGGGCTGGTGG + Intronic
984451671 4:179911257-179911279 CAGGGTGAAGAATAGTCTGGAGG - Intergenic
984542694 4:181060358-181060380 CAGAGGGAAGAAAAGGATGGGGG - Intergenic
984634702 4:182098255-182098277 CAGTATGAAGAACAGGATGGAGG + Intergenic
985819924 5:2152847-2152869 AAGGAAGAAGAAAGGGATGGAGG - Intergenic
985949198 5:3210554-3210576 CAAGATGAAGAAAAGGACTGCGG + Intergenic
985966602 5:3342843-3342865 GAGGAGGAAGAAGAGGCAGGTGG - Intergenic
986168315 5:5294750-5294772 TGGGATCAGGAAAAGGCTGGAGG + Intronic
986499638 5:8385457-8385479 CAGGATGAAGGAAGGGCTCTTGG - Intergenic
986594625 5:9408342-9408364 CAGGAAGTAGAAAAGTCTAGTGG - Intronic
986603276 5:9495663-9495685 GAGGATGAAGAGAAAACTGGCGG + Intronic
987328103 5:16830869-16830891 GAGGATGAAGAACAGACTGGTGG + Intronic
987589965 5:19911684-19911706 CAGCAAGAAGAAAATGCTGGTGG - Intronic
987759067 5:22135640-22135662 AAGAATGAAGAGAAGGCTGGAGG + Intronic
988929671 5:36024936-36024958 CAGGATGAAGAGAAATCTGAAGG + Intergenic
989209899 5:38847939-38847961 CAGGTTAAAGAAAAGGGTAGAGG - Intronic
989541227 5:42621186-42621208 CAGTAGGAAGGAAAAGCTGGAGG + Intronic
989553716 5:42766336-42766358 CACTATGAAGAACAGCCTGGAGG + Intronic
990505589 5:56441205-56441227 GAGGATGGGGGAAAGGCTGGAGG - Intergenic
991204964 5:64039587-64039609 CAGGAGGAAGAAAAGGAGAGAGG - Intergenic
991424371 5:66475548-66475570 CAGTATTAAGAAAGGGCTTGTGG + Intergenic
991893779 5:71369086-71369108 AAGAATGAAGAGAAGGCTGGAGG + Intergenic
992483544 5:77174511-77174533 CAGTATAAATAAAAAGCTGGTGG - Intergenic
992770637 5:80044009-80044031 CAGCAGGAACAAAAGGATGGAGG - Intronic
993133686 5:83930284-83930306 CAGGATGAAAGAATGGCAGGGGG + Intergenic
993302917 5:86235591-86235613 GAGGATGAGGAAAAGGATGGGGG + Intergenic
993407461 5:87529300-87529322 CAAAAGGAAAAAAAGGCTGGGGG + Intergenic
993860701 5:93133433-93133455 CAGAATGAAGCAAAGACAGGAGG + Intergenic
994670152 5:102754692-102754714 CAGGCTGGAGCAAGGGCTGGGGG + Intronic
995229250 5:109740054-109740076 CAGGCTTAACAAAGGGCTGGAGG - Intronic
995584467 5:113633311-113633333 CAGGATGAAGAATTGGCTGGAGG + Intergenic
996088965 5:119331707-119331729 CTGCAGGAAGACAAGGCTGGAGG - Intronic
996264044 5:121513170-121513192 CAAGATGAAGTAAAGGATAGAGG - Intergenic
996435446 5:123428914-123428936 CAGGATGAAGGAAAGTGTAGTGG + Intergenic
996574197 5:124963733-124963755 CAGGATGTAAAAAAAGATGGAGG - Intergenic
996812029 5:127526737-127526759 CAGGATGAAGCATCTGCTGGTGG + Exonic
998253079 5:140565594-140565616 CAGTATGTAGGAAAGGCAGGAGG - Exonic
998253820 5:140570040-140570062 CAGGGTGCAGACTAGGCTGGGGG - Intronic
998920777 5:147065518-147065540 CAGTGTGAAGAATAGACTGGAGG + Intronic
999286364 5:150396583-150396605 CAAGAAGAAGAAGAAGCTGGGGG + Exonic
999297147 5:150466841-150466863 CAGGAGGAAAAGAAGGCAGGAGG - Intergenic
1000240280 5:159402604-159402626 AAGGATGAAGAAAAGCATGAAGG - Intergenic
1000606149 5:163329857-163329879 CAGGATTTAGACTAGGCTGGAGG + Intergenic
1001663813 5:173416147-173416169 CAGGCTGAAGATAACGTTGGGGG - Intergenic
1002653295 5:180720724-180720746 CAGGAGGAAGAGAAGGCCGTGGG - Intergenic
1003941545 6:11033038-11033060 CTGGTCGAAGAAAAGGCTAGAGG - Intronic
1004168525 6:13277446-13277468 CAGGAACAAGACAAGGCAGGAGG - Intronic
1004609118 6:17222389-17222411 CAGGATGGAGAAAAGAGTGAAGG - Intergenic
1004877587 6:19971234-19971256 CAGGAGAATGGAAAGGCTGGAGG + Intergenic
1005500609 6:26426104-26426126 AAGGAAGAAGAAAAGGATGAGGG - Intergenic
1006143738 6:31946058-31946080 CAGATTGTATAAAAGGCTGGGGG + Exonic
1006315671 6:33290070-33290092 GAGGAAGCAGAAAAGGATGGGGG - Intronic
1006446916 6:34084765-34084787 CAGTAGGAACAAAAGCCTGGAGG - Intronic
1006523007 6:34582900-34582922 CTGAATGAAGAAGAGACTGGGGG - Intergenic
1006796926 6:36737828-36737850 CAGGATGGTGCAGAGGCTGGAGG - Intergenic
1007133777 6:39501081-39501103 AAGAATGAAGAAAAGGGTGACGG + Intronic
1008392544 6:50969590-50969612 CAGGATGTAGGAAAGGCTGAGGG + Intergenic
1008536794 6:52512373-52512395 CTGGAGGAGGAAAAGGGTGGAGG + Intronic
1010930102 6:81791246-81791268 CAGTATCAAAAAGAGGCTGGAGG - Intergenic
1011033660 6:82950434-82950456 CAGTATGAAGAACAGTTTGGAGG + Intronic
1011074429 6:83423162-83423184 CAGGAAAAAGAAAGGGCGGGAGG + Intronic
1011354669 6:86461711-86461733 GAGGAGGAGGAAAAGGATGGGGG + Intergenic
1011735216 6:90303462-90303484 CATGATTAAGAAAGGTCTGGTGG + Intergenic
1012444470 6:99293937-99293959 CAGGAGGGGGAAATGGCTGGAGG + Intronic
1012491406 6:99786639-99786661 CAGGGTCAAGAAATGGCTTGCGG + Intergenic
1012949517 6:105503253-105503275 CAGGCTGCAGAGGAGGCTGGAGG - Intergenic
1013757656 6:113480407-113480429 CAGGACGAAGTAAAGGCATGAGG + Intergenic
1013858124 6:114600236-114600258 CAAGATGAATAAAAAGGTGGAGG - Intergenic
1014051744 6:116963071-116963093 CAGTGTGGAGAAAAGGCTGTGGG - Intergenic
1014081269 6:117288667-117288689 CAAGGTGAAGAAAAGTCTGAGGG - Exonic
1015121127 6:129702696-129702718 CAGAATCAAGAAGAGGCAGGAGG + Intronic
1015812401 6:137173897-137173919 CTGGTTGAAGAAAATGCTGTTGG - Intergenic
1016295549 6:142569760-142569782 CAGGAAGAGGGAAAGGGTGGAGG + Intergenic
1016622290 6:146125693-146125715 CAGAATGGAGAAAAGGAGGGGGG - Intronic
1017013864 6:150084295-150084317 CAGGATGGAGCTCAGGCTGGTGG + Intergenic
1017086583 6:150718231-150718253 CTGCATGAACAAAAGCCTGGTGG + Intronic
1017111985 6:150940949-150940971 ACAGATGAAGAAAAGACTGGAGG - Intronic
1018244005 6:161804411-161804433 TAGGAGGAAGGCAAGGCTGGTGG + Intronic
1020028375 7:4915860-4915882 CAGGAAGGAAAAAAGGGTGGCGG + Intronic
1020664059 7:11017310-11017332 CATGATGAAGAAAACTTTGGAGG - Intronic
1020676889 7:11193632-11193654 CAGGATGTAAAACATGCTGGAGG - Intergenic
1020851915 7:13364313-13364335 CAGGTATAAGAAGAGGCTGGAGG - Intergenic
1021550653 7:21867945-21867967 CAGGATGAAGAATATGGGGGTGG - Exonic
1021757982 7:23873987-23874009 CAGAATGTAGAAAAGACTGATGG - Intergenic
1021971102 7:25966768-25966790 AAGGAAGAAGAAAGGGATGGAGG + Intergenic
1022405460 7:30085832-30085854 AAGGAAGAAGAAGAAGCTGGTGG + Intronic
1022417567 7:30191071-30191093 CTGGCTGAAGACCAGGCTGGAGG + Intergenic
1022652001 7:32285894-32285916 AAGGATGAAGATAATGCAGGGGG - Intronic
1022769867 7:33457958-33457980 CAGGATCAGGAAAAGGTTTGAGG + Intronic
1024124760 7:46281990-46282012 CAAGATTTAGAAAAGGCTTGAGG + Intergenic
1024436843 7:49366525-49366547 CAGAAAGAAAAAAAAGCTGGAGG - Intergenic
1024456818 7:49617930-49617952 CAGGAAGAAGAAATGTCTGGGGG + Intergenic
1024527518 7:50361418-50361440 CAGGTTGAAGAACAGGCTTAGGG - Intronic
1024655302 7:51446897-51446919 CAGGATAAAAAACAGGATGGAGG - Intergenic
1025254382 7:57373551-57373573 CAGTATGAAAAAAAAGCTGATGG - Intergenic
1025295472 7:57772594-57772616 CAGGATGAAGAAACCCCCGGCGG + Intergenic
1025296237 7:57776978-57777000 CAAGAGGAAGAAACCGCTGGCGG + Intergenic
1025967130 7:66284415-66284437 CAGTATGAAGAAAAAGCATGTGG - Intronic
1026284831 7:68954036-68954058 CAGGAAGAAGAAAAATCAGGAGG - Intergenic
1026621464 7:71953305-71953327 TAAGATGAAGAACAGGATGGAGG - Intronic
1026832555 7:73618955-73618977 CAGGAGGAAGAAAAGGATTTGGG + Intronic
1026890235 7:73977454-73977476 CTGGCTGAAGAAAGGGCAGGTGG + Intergenic
1027229978 7:76267125-76267147 CAGCATGGTGAAAAGGCAGGTGG + Intronic
1027476014 7:78632362-78632384 CAGTATGGAGAAAAGGGTGGAGG + Intronic
1028036344 7:85988707-85988729 CAGTGTGCAGATAAGGCTGGAGG + Intergenic
1028791069 7:94853586-94853608 CAGGGAGAAGAGAAGGATGGGGG - Intergenic
1029874206 7:103731666-103731688 CTGGAGGTAGAAAAGCCTGGGGG + Intronic
1030273701 7:107696967-107696989 CAGGAAGGAGAACTGGCTGGTGG - Intronic
1030528123 7:110677990-110678012 GAGGATGAAGAAAATGATGCTGG - Intronic
1030827813 7:114182970-114182992 CAGAATGCAGGAAAGGCTGAAGG + Intronic
1031451274 7:121923143-121923165 CAGGTAGAAGAAAAGGCATGAGG - Intronic
1032089980 7:128906650-128906672 AAGGAGGAAGGAAAGACTGGGGG + Intronic
1032444934 7:131974210-131974232 CAGGAAGAAGACAGGGCTGTGGG - Intergenic
1032461522 7:132114814-132114836 CAGGATGAAGAAAAGGCCACAGG + Intergenic
1033019419 7:137707615-137707637 CAGGAGGAAGAAAAAGAGGGTGG - Intronic
1033683892 7:143621567-143621589 CAGTATTAAGAAAAAGGTGGCGG + Intronic
1033700720 7:143836071-143836093 CAGTATTAAGAAAAAGGTGGCGG - Intergenic
1034285648 7:149881599-149881621 CAGGAGGAAGATGAGGCTGCAGG + Intergenic
1034490788 7:151392185-151392207 CAGGCTGCAGCATAGGCTGGGGG - Intronic
1034855785 7:154545428-154545450 AAGGATGAAGAAAAGGAGGGAGG - Intronic
1034869618 7:154672493-154672515 CAGCATGAAGAATTGGATGGTGG + Intronic
1036637101 8:10558742-10558764 CAGGATAAAGACAAGGCTAGGGG - Intergenic
1036751345 8:11445350-11445372 CTGGATGTAGAAACGGCTGCTGG - Intronic
1037877387 8:22554683-22554705 CAGGAGGATGAAAGGGATGGAGG + Intronic
1038265763 8:26039238-26039260 CAGGCAGAAAAAAAGGGTGGGGG + Intronic
1038356269 8:26832045-26832067 GAGGGGGAAGAGAAGGCTGGTGG - Intronic
1038478140 8:27883376-27883398 CAGGATGGTGAAAAGGATGTGGG - Intronic
1038533899 8:28340073-28340095 CAGGATGGACAAATGGCTTGTGG - Intronic
1038535029 8:28347603-28347625 CAGGATGAGGAAATGACAGGAGG - Exonic
1039341408 8:36654176-36654198 CAGAAAGTAGAAGAGGCTGGTGG - Intergenic
1039862300 8:41469255-41469277 CAGAAAGAAGAAAAGGAGGGAGG - Intergenic
1039977696 8:42381285-42381307 CAGGATGAAAATCAGGTTGGGGG + Intergenic
1040875392 8:52146350-52146372 AAGAATGAAGAAATGGCAGGTGG - Intronic
1041234124 8:55781666-55781688 CAGGATGATGAACAGGCAAGGGG - Intronic
1041246776 8:55895866-55895888 CAAAATCAAGAAAAGGCTCGGGG - Intronic
1042566425 8:70116775-70116797 CAGCATGAAGAAAGTGCAGGTGG + Intronic
1042572766 8:70184707-70184729 AAGGATGAAGGAAAGGAAGGGGG + Intronic
1042795765 8:72662059-72662081 CAGGATGAAGAACTGGATGCTGG - Intronic
1042811143 8:72826439-72826461 CTGGAAGAAGAGAAGGCTGCGGG + Intronic
1043222721 8:77687218-77687240 CCGGATCATGAAAAGGCTGCAGG + Intergenic
1045097757 8:98816164-98816186 CAGGAAAAGGAAAAGGATGGAGG + Intronic
1045369257 8:101505190-101505212 CAATATGAAGAAAAGGATGGGGG - Intronic
1046373428 8:113343095-113343117 CAGGAGGAAGAAAAGACTGAAGG + Intronic
1047017169 8:120735818-120735840 AAGGAGGAAGAACAGGCAGGAGG + Intronic
1047200072 8:122757762-122757784 TAGGATGAAGAAGAAGCTGTTGG + Intergenic
1048334292 8:133491481-133491503 CAGCATAAAGGAAGGGCTGGAGG + Intronic
1048938916 8:139379866-139379888 GCTGATGAAGAAGAGGCTGGTGG + Intergenic
1049758078 8:144319639-144319661 CAGGAAGCAGAAGAGGCAGGCGG - Intronic
1050371319 9:4924275-4924297 CAGGAGGAAGACAAGACTGAGGG - Intergenic
1050689168 9:8205807-8205829 AAGGATAAATAAAAGGGTGGAGG - Intergenic
1051194982 9:14554360-14554382 CTGGATGAGGAAAAGGCTGAAGG - Intergenic
1051818211 9:21134217-21134239 CAGGGTGAAGAACAGCCTGATGG - Intergenic
1052325019 9:27208413-27208435 CAGAATGAAGAGAAGGCTATTGG - Intronic
1052391472 9:27883237-27883259 CAGGAGGAAGAAAGAGCAGGCGG - Intergenic
1053469171 9:38333402-38333424 CAGGATCAAGAGAAAGCTGGAGG - Intergenic
1054761949 9:69012248-69012270 AAGGGTGAAGAAAAGTCTGCTGG + Intergenic
1056213353 9:84385749-84385771 CAGTAGGAAGAAAAGGATGTGGG - Intergenic
1056504700 9:87247220-87247242 CAGTAGGAAGTACAGGCTGGGGG + Intergenic
1056546916 9:87620859-87620881 CAGGCTGAAGAGATGCCTGGAGG + Intronic
1056667978 9:88597168-88597190 AGGGAGGAAGGAAAGGCTGGAGG - Intergenic
1056922143 9:90800888-90800910 CTGGAAGCAGAAAAGGCTGGGGG + Intergenic
1057457562 9:95228179-95228201 GAGGATGAAGAAAAGATGGGAGG + Intronic
1058010620 9:99972824-99972846 AAGGATGAGGAAAAGCCTGGGGG + Intergenic
1058050653 9:100402930-100402952 GAGGAAGAAGAAGAGGGTGGAGG - Intergenic
1058171277 9:101684068-101684090 CAGGAAGAAGGAAAGGAAGGGGG - Intronic
1058400540 9:104613163-104613185 CAGAAGGAAGAGAAGGATGGAGG + Intergenic
1059076217 9:111196695-111196717 GAGAATGAAGAAAAGCCGGGGGG + Intergenic
1059471652 9:114509363-114509385 CAGGAGGAAGAAGAGGCTCAAGG + Intergenic
1059611386 9:115900767-115900789 GAAGATGAAGAAAAGGGAGGAGG - Intergenic
1060606446 9:124918837-124918859 CAGGAGGCAGAAAAGGCAGAAGG - Intronic
1060691825 9:125668646-125668668 CAGCAAGAAGAAAAGACTTGGGG - Intronic
1060705094 9:125791552-125791574 CAGGAGGAAGAGAGGGCAGGGGG - Intronic
1061107741 9:128545010-128545032 CAGGATGAAGAAAAGTGAAGGGG - Intergenic
1061845183 9:133383982-133384004 CTGGATGAAGAGAAGGCTGGAGG + Intronic
1062067508 9:134536655-134536677 AAGGATGGAGAGAATGCTGGGGG - Intergenic
1185763932 X:2709068-2709090 CATGTGGAGGAAAAGGCTGGTGG + Intronic
1185985095 X:4823856-4823878 AAGGCTGAAGAAAATGCTAGTGG - Intergenic
1186402589 X:9273567-9273589 AAGGATGAAGAAAAGGAAGAAGG + Intergenic
1187118301 X:16376060-16376082 AAGGAGGAAGAATAGGATGGAGG + Intergenic
1187260365 X:17679847-17679869 CAGAATGAAGAAAGGGGGGGGGG + Intronic
1187493950 X:19778044-19778066 CAGGAAGAAAAAAAAGCTGGAGG + Intronic
1187695166 X:21912323-21912345 CAGGAAGAAGGAAAGGCTTTGGG - Intergenic
1187992918 X:24895418-24895440 CAAGATGGAGAAAAGGCTGAAGG + Intronic
1188529264 X:31120720-31120742 CAGGACGATGATAGGGCTGGAGG - Exonic
1189188037 X:39070780-39070802 CAGGAGGAAAAGAAGGTTGGGGG - Intergenic
1189282596 X:39829313-39829335 GAGCATGAAGAAAAAGATGGTGG - Intergenic
1190212511 X:48459605-48459627 GAGGATGAAGATGAGGCTGGGGG + Exonic
1190627477 X:52350646-52350668 AAAGCTGAAGAAAAGACTGGAGG - Intergenic
1191902428 X:66054335-66054357 CAGGATGTAGACAAGGCAGGTGG + Intergenic
1192807419 X:74522937-74522959 CAGGATGCAGGCAGGGCTGGTGG + Intronic
1194046971 X:89019764-89019786 CACTATGAAGAACAGGTTGGAGG + Intergenic
1194769218 X:97880232-97880254 CAGAATGGAGACAAGGTTGGAGG + Intergenic
1195031183 X:100929059-100929081 CAGGATGAAGAAAAGGCTGGAGG + Intronic
1195301045 X:103530260-103530282 CACGTTGAAGAAAAGGACGGTGG + Intergenic
1196499235 X:116359780-116359802 CACTATGAAGAACAGTCTGGAGG + Intergenic
1198250039 X:134870807-134870829 GAGGAGGAAGGATAGGCTGGTGG + Intergenic
1198783515 X:140261669-140261691 CTGGAAGAAGAAAATGGTGGTGG + Intergenic
1199019503 X:142860663-142860685 CAGGATGAAGATCAGATTGGAGG + Intergenic
1199537439 X:148918669-148918691 CAGGAGGAAGGAAAGGGAGGAGG + Intronic
1199727805 X:150602077-150602099 AGGCATGAAGAAAAGGCTGCAGG - Intronic
1200010249 X:153114962-153114984 GGTGATGAAGAACAGGCTGGGGG + Intergenic
1200029351 X:153284960-153284982 GGTGATGAAGAACAGGCTGGGGG - Intergenic
1201963626 Y:19708202-19708224 CCAGATGAAGAAGAGGCTGTGGG + Intronic