ID: 1195039237

View in Genome Browser
Species Human (GRCh38)
Location X:100999096-100999118
Sequence GGGACATTCATGATACATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195039237_1195039239 -7 Left 1195039237 X:100999096-100999118 CCTCCATGTATCATGAATGTCCC No data
Right 1195039239 X:100999112-100999134 ATGTCCCTAACAGTCACAAATGG No data
1195039237_1195039243 28 Left 1195039237 X:100999096-100999118 CCTCCATGTATCATGAATGTCCC No data
Right 1195039243 X:100999147-100999169 TTACATGTTCCTCCATTGTGTGG No data
1195039237_1195039242 1 Left 1195039237 X:100999096-100999118 CCTCCATGTATCATGAATGTCCC No data
Right 1195039242 X:100999120-100999142 AACAGTCACAAATGGACTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195039237 Original CRISPR GGGACATTCATGATACATGG AGG (reversed) Intergenic
No off target data available for this crispr