ID: 1195040313

View in Genome Browser
Species Human (GRCh38)
Location X:101008153-101008175
Sequence CCTATAAGGTAACTTCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195040313_1195040318 1 Left 1195040313 X:101008153-101008175 CCAAGAGGAAGTTACCTTATAGG No data
Right 1195040318 X:101008177-101008199 AGTTGGATACAGGAATGAAAAGG No data
1195040313_1195040317 -9 Left 1195040313 X:101008153-101008175 CCAAGAGGAAGTTACCTTATAGG No data
Right 1195040317 X:101008167-101008189 CCTTATAGGTAGTTGGATACAGG No data
1195040313_1195040319 16 Left 1195040313 X:101008153-101008175 CCAAGAGGAAGTTACCTTATAGG No data
Right 1195040319 X:101008192-101008214 TGAAAAGGAACTCTGTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195040313 Original CRISPR CCTATAAGGTAACTTCCTCT TGG (reversed) Intergenic
No off target data available for this crispr