ID: 1195040317

View in Genome Browser
Species Human (GRCh38)
Location X:101008167-101008189
Sequence CCTTATAGGTAGTTGGATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195040313_1195040317 -9 Left 1195040313 X:101008153-101008175 CCAAGAGGAAGTTACCTTATAGG No data
Right 1195040317 X:101008167-101008189 CCTTATAGGTAGTTGGATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195040317 Original CRISPR CCTTATAGGTAGTTGGATAC AGG Intergenic
No off target data available for this crispr