ID: 1195041616

View in Genome Browser
Species Human (GRCh38)
Location X:101019966-101019988
Sequence CAAGGTTCTCATCTTGGTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195041616 Original CRISPR CAAGGTTCTCATCTTGGTAT AGG (reversed) Intronic
906669346 1:47643327-47643349 CAAGCCTCTCCCCTTGGTATAGG - Intergenic
907913352 1:58846523-58846545 CACGTTTCTCATCTTGGCAGTGG - Intergenic
913678266 1:121163375-121163397 CAGGCTTCTCATCTTAGTTTAGG - Intergenic
914030105 1:143951015-143951037 CAGGCTTCTCATCTTAGTTTAGG - Intronic
914159345 1:145116936-145116958 CAGGCTTCTCATCTTAGTTTAGG + Intergenic
916888400 1:169092922-169092944 CCACGTTCTCATCTTGGAAACGG - Intergenic
919845081 1:201636949-201636971 CAACGTTCTCATCATGGCATTGG + Intronic
920465573 1:206181899-206181921 CAGGCTTCTCATCTTAGTTTAGG - Intergenic
921272393 1:213484297-213484319 CAAGGTTCCAATCATGGTGTTGG + Intergenic
922493135 1:226034730-226034752 CAAGGCTGTCATCATGGTGTCGG - Intergenic
922707788 1:227798746-227798768 CAAGGTCCTCATCTTGACAATGG - Intergenic
1063330563 10:5154958-5154980 AAAGGATCTTATCTTGGTAAAGG + Intergenic
1064726795 10:18288233-18288255 CAATGTTCTGATGTTGTTATGGG - Intronic
1066237729 10:33502613-33502635 CAAGGTTCTGTCCTTGGTAGAGG - Intergenic
1067766757 10:49092733-49092755 CTAGGTTCTCAACTTTTTATAGG - Intronic
1068374877 10:56165256-56165278 CCAAGTTCTCCTATTGGTATGGG + Intergenic
1069770986 10:70899797-70899819 CAAGGTTGTCCTTTTGTTATTGG + Intergenic
1073519386 10:104112537-104112559 CAAGGTCCTAATCTTGAGATTGG + Intergenic
1074190817 10:111134935-111134957 CAAGGAGATCTTCTTGGTATTGG + Intergenic
1075325100 10:121525227-121525249 GAAGGTTCTCATCTTGTTCCAGG - Intronic
1081599534 11:44483771-44483793 CAAGGGTCTCATCTGGGAATTGG - Intergenic
1083183491 11:61003874-61003896 CCAGGTTCCCTTCTTGGGATAGG + Intronic
1086057963 11:82670021-82670043 TTTGGTTCTCATCTTGTTATTGG - Intergenic
1093298401 12:17420525-17420547 CAAGGTTCTCAACCTGATAAAGG - Intergenic
1097871874 12:64609185-64609207 CTGGGTTCTCTGCTTGGTATCGG - Intergenic
1101530313 12:105567577-105567599 CAAGGTTCTCAAATTTGAATAGG + Intergenic
1101825392 12:108216564-108216586 CAAGGTTCACATCCCTGTATTGG - Intronic
1102767004 12:115442372-115442394 CCAGGCTCTCAACTTGGTCTTGG + Intergenic
1111614016 13:90641211-90641233 AAAGGTTCTAATCTTGGTGTAGG + Intergenic
1112933600 13:104771287-104771309 CACTGTTCTTATCTTGGTGTAGG + Intergenic
1114218077 14:20672614-20672636 TACGGTTCTCAACTTGGTTTGGG + Intergenic
1122336661 14:100993920-100993942 CAAAGTTCTTGTCTTGGTTTGGG + Intergenic
1123849326 15:24339053-24339075 CTAAGTCCTCATCTTGGAATAGG - Intergenic
1126872669 15:53006640-53006662 CTAGGTTGCCATCTTGTTATGGG - Intergenic
1128033808 15:64505495-64505517 CTAGGTTTTCTACTTGGTATTGG + Intronic
1128062096 15:64741664-64741686 CAGTGTTCTCATCTAGCTATAGG + Intronic
1129900012 15:79140018-79140040 CAAGCTTCTCATCTTGGAAAGGG + Intergenic
1130627475 15:85530403-85530425 CAGGTTTCTCATCTTTGCATAGG + Intronic
1142703065 17:1676229-1676251 CAAGTTGCTCATCTTGGCATTGG - Exonic
1144660961 17:17070723-17070745 CATGGCTGTCATCTTGGTGTTGG + Intronic
1147946381 17:44082584-44082606 CAAGGTCCTCATCGTGGACTGGG - Exonic
1155972687 18:32096254-32096276 CAGGGTTTTCAGCTTGGTAGTGG + Intronic
1155983090 18:32201040-32201062 CAAAGATCTTATCTTGGTAAAGG + Intronic
1159137759 18:64357069-64357091 CAATGTTGTCATCTTGATCTTGG - Intergenic
1159766135 18:72490440-72490462 CCAGGTTCTCAGCTGGGTAATGG + Intergenic
1162730324 19:12714900-12714922 CAACGTTCTCATCATGGTCCTGG + Exonic
1164689180 19:30196040-30196062 CAAGGTTCACTTCTTTGCATAGG - Intergenic
1166327528 19:42060283-42060305 CCAGGCTCTGCTCTTGGTATTGG + Intronic
1166327627 19:42060990-42061012 CCAGGCTCTGATCTTGGTATTGG - Intronic
1166935518 19:46330171-46330193 CAAGGCTCCCAGCTTGGTACTGG + Intronic
1166948306 19:46410739-46410761 CAAGGTGCTCAGCTTGATAAAGG - Exonic
1168135177 19:54346177-54346199 CCAGGTTCTCACCCTGGTAGGGG - Intergenic
926448185 2:12970215-12970237 CAATGTTCTCATCTGGTCATGGG - Intergenic
926990535 2:18675557-18675579 CAAAGTTTTCATCTTGGCTTGGG + Intergenic
927117973 2:19923863-19923885 CCAGGTTCTCATTTTGTAATGGG + Intronic
928134497 2:28678105-28678127 CAAGGTTCTCAACTGGGTTCTGG + Intergenic
929090427 2:38211213-38211235 CAGCTTTCTCATCTTGGTGTTGG - Intergenic
929264072 2:39899039-39899061 CAAGCTTCTCATCATGGCTTTGG + Intergenic
929954610 2:46446731-46446753 CAGGTTTCTAATCTTGGTGTGGG - Intronic
930140557 2:47947564-47947586 CAACATCCTCATCTTGGAATGGG - Intergenic
931129422 2:59317286-59317308 GAAGGTTCTCATTTTTGTCTTGG - Intergenic
939162803 2:138609398-138609420 CAGGATTCCCATCTTGGTGTTGG + Intergenic
944985008 2:205166620-205166642 CAAGGTTCTTTTCTTAGTTTAGG + Intronic
946173337 2:217908283-217908305 GAAGTTTCTCTTCTTGCTATGGG - Intronic
1169255034 20:4090809-4090831 CATGGTTTTCATCGTGGTCTTGG - Intergenic
1171229109 20:23468033-23468055 CCAGGTTCTCCTTTTGGAATGGG + Intergenic
1178233498 21:30814551-30814573 CAAGTGTCTCATCTTGTTCTTGG - Intergenic
1178737627 21:35167072-35167094 CAAGGAGCTCATCTTCTTATAGG - Intronic
1178899862 21:36590303-36590325 CAAGTTTCTCATTTTGCTACTGG + Intergenic
1182332703 22:29562110-29562132 CAATGTTCTCATCTTGAAAATGG + Intronic
1182635470 22:31723176-31723198 TAAGGGTCTCAGTTTGGTATAGG - Intronic
1184631239 22:45781634-45781656 CCATGTCATCATCTTGGTATTGG - Intronic
1184961262 22:47930526-47930548 CATGATTCTGATCTTAGTATTGG - Intergenic
949435014 3:4019760-4019782 CAAGGGTCTTATCTTTCTATGGG - Intronic
952027179 3:29097985-29098007 CAAAGATTTCATCTTGGTTTGGG + Intergenic
957315637 3:78572649-78572671 CAATGTTCTAATACTGGTATAGG + Intergenic
957753455 3:84455158-84455180 CAAAGTTCTATTATTGGTATTGG + Intergenic
960162684 3:114367661-114367683 GAATGTTGTCTTCTTGGTATAGG - Intronic
962554864 3:136538044-136538066 CATGGTTCTAATGTTGGTAATGG - Intronic
962958884 3:140291726-140291748 CAAAGTTCTCCTTTTGGCATTGG - Intronic
963958345 3:151280268-151280290 CATGGGCCTCATCTTGGGATGGG + Intronic
966092459 3:176156813-176156835 CAAATTTCTCATTTTGTTATGGG + Intergenic
966968373 3:185018655-185018677 CCAGGTTCTCCTCTTGTAATGGG - Intronic
977124426 4:93146887-93146909 CTAGTTTCTAATCTGGGTATTGG + Intronic
978607550 4:110498262-110498284 CAAGGATCTCAGCTTGTTTTTGG + Intronic
979063968 4:116102846-116102868 CAAGATTCTCTTTTTGATATTGG - Intergenic
979746064 4:124214711-124214733 CAAGGTTTCCCCCTTGGTATAGG - Intergenic
980864497 4:138538897-138538919 CAAGGGTGTCAACTTGGGATAGG + Intergenic
981896558 4:149808719-149808741 CAAGTTTCTCAACTTGGGAGAGG + Intergenic
984078172 4:175209018-175209040 TAAGGTTCTCTTCCTGGTACAGG + Intergenic
984606675 4:181793640-181793662 AAAGGTTTTCATCTTGGAATTGG - Intergenic
990435461 5:55786076-55786098 TAAAATTCTCATCCTGGTATGGG - Intronic
990456804 5:55995779-55995801 CAAGATTCTCATCTTCCTTTGGG - Intergenic
991307476 5:65194519-65194541 CAATGTTTTCAACTTTGTATAGG + Intronic
996587020 5:125100696-125100718 CAAGGTTCTCATCTTGACTCTGG + Intergenic
998322548 5:141246256-141246278 CCAGATCCTCATCTTGGTCTTGG + Exonic
999036633 5:148358853-148358875 CAATCTTCTCATCTGTGTATTGG + Intergenic
999658243 5:153831491-153831513 CAAGGTTATCACCTTGGGCTAGG - Intergenic
1001852586 5:174982481-174982503 CAAGTTTCTCATCTGTGTAGTGG - Intergenic
1002333141 5:178459087-178459109 CAAGGTTCCCATATTGTGATTGG - Intronic
1003785782 6:9485397-9485419 CTAGGATCCCAACTTGGTATAGG + Intergenic
1006915955 6:37594061-37594083 CAAGTTTCACACCCTGGTATGGG - Intergenic
1011276597 6:85637820-85637842 CAAGTTTCTAGACTTGGTATGGG - Intronic
1011578349 6:88828619-88828641 CAAGGTTCTCAGATTCGCATTGG - Intronic
1011904093 6:92339330-92339352 CAAGATTCTCATTTTGATATGGG - Intergenic
1012051669 6:94353453-94353475 CCTGGTTATCTTCTTGGTATTGG - Intergenic
1012505920 6:99946164-99946186 CAAGGCCCTCTTCCTGGTATTGG + Intronic
1012633250 6:101500276-101500298 CAAGATTCTCAGCTAAGTATAGG + Intronic
1016512112 6:144855013-144855035 CAAATTACACATCTTGGTATGGG + Intergenic
1020479789 7:8644388-8644410 AAAGGTTCTCACCTTGGCAATGG + Intronic
1030340041 7:108367689-108367711 CATGGTTCTCTGCTTGGTAAAGG - Intronic
1031201165 7:118688108-118688130 CAATGTTGTTATCCTGGTATAGG - Intergenic
1031775128 7:125899394-125899416 CAAGGTTTTCATCTTTTTTTAGG + Intergenic
1037223145 8:16550740-16550762 CCAGGTTCTCTTCTAGGTATAGG + Intronic
1039398758 8:37249584-37249606 TAAGGTGTTCATCTTGGAATAGG + Intergenic
1040956149 8:52982099-52982121 CAAAGTTCTCATCAAGGTTTAGG - Intergenic
1042117316 8:65446290-65446312 CAAGTTTCTCATCTTAAAATGGG + Intergenic
1043048152 8:75353073-75353095 CAGGGTTTTCTTCTTGGTTTGGG - Intergenic
1046829153 8:118725031-118725053 TATGGTTCTCATCTTGGTGAGGG + Intergenic
1047435191 8:124830131-124830153 CAAGGTGCTCCTCTAGGTGTGGG + Intergenic
1049120692 8:140734421-140734443 CCAGGTTCTAAGCTTGGCATTGG + Intronic
1050073784 9:1843088-1843110 CAATGTTCACATCTGGGCATTGG - Intergenic
1056118741 9:83466065-83466087 CATGGTGCTCATGTTGTTATGGG - Intronic
1056663456 9:88561666-88561688 CAAGGCTCCCCTCTTGTTATTGG - Intronic
1058153721 9:101488470-101488492 CAATGTTCTCATCTATATATTGG + Intronic
1059581298 9:115551297-115551319 CAGTGTTCTCATCTTTGTAGTGG + Intergenic
1060342189 9:122787557-122787579 CAATGTTCTCATCTGGATAATGG - Intergenic
1186406147 X:9305154-9305176 TAAGAATTTCATCTTGGTATAGG - Intergenic
1188094437 X:26004178-26004200 CAAAGATTTCATCTTGGTTTGGG - Intergenic
1190409212 X:50118067-50118089 GAAGAAGCTCATCTTGGTATAGG + Intergenic
1192119384 X:68440513-68440535 CCAGGTTTTCTTCTTGTTATTGG - Intergenic
1195041616 X:101019966-101019988 CAAGGTTCTCATCTTGGTATAGG - Intronic
1195810924 X:108828641-108828663 CAAGTTTTTCATCCTGGTAAAGG + Intergenic
1195906068 X:109845744-109845766 CAAGGTTGTCATCTTAGCAAGGG - Intergenic
1198911860 X:141624001-141624023 CAAGCTTCTCATATTGTTTTTGG - Intronic
1200978493 Y:9239170-9239192 CAAGGTTCTCCTTTTGTAATGGG + Intergenic