ID: 1195047618

View in Genome Browser
Species Human (GRCh38)
Location X:101068239-101068261
Sequence CTCTTCAGTGGTTCTCAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195047618_1195047621 3 Left 1195047618 X:101068239-101068261 CCATTCTGAGAACCACTGAAGAG No data
Right 1195047621 X:101068265-101068287 ATGATGGTCTGCACTATAACTGG No data
1195047618_1195047623 18 Left 1195047618 X:101068239-101068261 CCATTCTGAGAACCACTGAAGAG No data
Right 1195047623 X:101068280-101068302 ATAACTGGTGGCCTAATTAGTGG No data
1195047618_1195047622 6 Left 1195047618 X:101068239-101068261 CCATTCTGAGAACCACTGAAGAG No data
Right 1195047622 X:101068268-101068290 ATGGTCTGCACTATAACTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195047618 Original CRISPR CTCTTCAGTGGTTCTCAGAA TGG (reversed) Intergenic
No off target data available for this crispr