ID: 1195048730

View in Genome Browser
Species Human (GRCh38)
Location X:101078257-101078279
Sequence ACCACTCATCTATCTACTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195048730_1195048736 28 Left 1195048730 X:101078257-101078279 CCGTGAGTAGATAGATGAGTGGT No data
Right 1195048736 X:101078308-101078330 CTAAATCTCCAAAGAGAGACAGG No data
1195048730_1195048738 30 Left 1195048730 X:101078257-101078279 CCGTGAGTAGATAGATGAGTGGT No data
Right 1195048738 X:101078310-101078332 AAATCTCCAAAGAGAGACAGGGG No data
1195048730_1195048733 -8 Left 1195048730 X:101078257-101078279 CCGTGAGTAGATAGATGAGTGGT No data
Right 1195048733 X:101078272-101078294 TGAGTGGTGGCGTGTGGCAGTGG No data
1195048730_1195048737 29 Left 1195048730 X:101078257-101078279 CCGTGAGTAGATAGATGAGTGGT No data
Right 1195048737 X:101078309-101078331 TAAATCTCCAAAGAGAGACAGGG No data
1195048730_1195048734 -7 Left 1195048730 X:101078257-101078279 CCGTGAGTAGATAGATGAGTGGT No data
Right 1195048734 X:101078273-101078295 GAGTGGTGGCGTGTGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195048730 Original CRISPR ACCACTCATCTATCTACTCA CGG (reversed) Intergenic
No off target data available for this crispr