ID: 1195050105

View in Genome Browser
Species Human (GRCh38)
Location X:101089097-101089119
Sequence GTAAAACCTTGGGCTGAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195050105 Original CRISPR GTAAAACCTTGGGCTGAAAG GGG (reversed) Intronic
901059148 1:6464052-6464074 TTTAAAACTTGGGCTGAAGGAGG - Intronic
901201253 1:7468687-7468709 GTAAGAACTTGGGGTGACAGAGG - Intronic
905222183 1:36455919-36455941 GGAAAACCTGGGGATGAAAAGGG + Exonic
908267223 1:62391330-62391352 GGAAAAACTGGAGCTGAAAGGGG + Intergenic
911740387 1:101380590-101380612 GGATAGCCTTGGGTTGAAAGAGG - Intergenic
911870952 1:103097934-103097956 ATAAAAGCTTGACCTGAAAGTGG + Intronic
913676129 1:121142405-121142427 GAAAAAGCTTGTGGTGAAAGGGG - Intergenic
914028022 1:143930349-143930371 GAAAAAGCTTGTGGTGAAAGGGG - Intergenic
919428220 1:197460498-197460520 GCACAACCCTTGGCTGAAAGAGG - Intronic
920463497 1:206161243-206161265 GAAAAAGCTTGTGGTGAAAGGGG - Intergenic
1063944223 10:11161673-11161695 GTAAATTCTTGGACTGTAAGAGG + Intronic
1065191801 10:23218436-23218458 TTAAAACCTGGGGCTGGGAGTGG - Intronic
1068592894 10:58868062-58868084 GTAAAGCCTTGGCCAGAAACTGG - Intergenic
1070361273 10:75691847-75691869 GTACCACCTCTGGCTGAAAGGGG - Intronic
1071661117 10:87504328-87504350 CAAAAACCTTGGGCTTCAAGAGG + Intergenic
1074428322 10:113371581-113371603 GTATAACCTAAGACTGAAAGGGG - Intergenic
1076318757 10:129563602-129563624 GTAAAGGCCTGGGCAGAAAGGGG - Intronic
1081515111 11:43821144-43821166 GTAAAACCATCGGATGAAACTGG - Intronic
1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG + Intronic
1088352995 11:108910689-108910711 TTAAAGCCCTGGGCAGAAAGGGG - Intronic
1091297145 11:134482013-134482035 CTACACCCTTGGGCTGAGAGTGG - Intergenic
1096109378 12:49020115-49020137 GCACAAGCTTGGGCAGAAAGGGG + Exonic
1096752618 12:53771666-53771688 ATAAATCTTTGGGCTGAAAAGGG + Intergenic
1098111019 12:67121915-67121937 GTAAACCAATGGGCTGAAAATGG + Intergenic
1102407925 12:112690342-112690364 GGAAAACCTTGGGACAAAAGGGG - Intronic
1105416960 13:20221604-20221626 GGAAATCCTTGGGGGGAAAGAGG + Intergenic
1117456162 14:55898970-55898992 GGAAGATCTTGGGCTGATAGAGG - Intergenic
1120081582 14:80223403-80223425 GTAAAACTTTGGGCTGGAAAAGG + Intronic
1121454194 14:94027858-94027880 GTAAACCCTTGGGCACCAAGTGG - Intronic
1127001536 15:54513911-54513933 CTAAAACTTTGAGCTGAAAATGG - Intronic
1130606751 15:85324617-85324639 GTGAAAACTTAGGCTGAAAGAGG + Intergenic
1134282136 16:12826541-12826563 GAAAAAACTTGGGCTCAGAGAGG + Intergenic
1134902092 16:17947668-17947690 ATAAGACCTTGGGCTGAGAGAGG - Intergenic
1135413656 16:22253053-22253075 GGGAAACCCTGGGCTCAAAGAGG + Intronic
1137939184 16:52666186-52666208 GTAAAACCTATGACTGCAAGGGG - Intergenic
1138032260 16:53569029-53569051 TTTCAACCTTGTGCTGAAAGTGG + Intergenic
1139847211 16:69929530-69929552 GTAAGGACTTGGGCTGAGAGGGG + Intronic
1203072818 16_KI270728v1_random:1096355-1096377 GTAAACATTTGGACTGAAAGAGG - Intergenic
1145909259 17:28533199-28533221 CAGAAACTTTGGGCTGAAAGGGG + Intronic
1146728708 17:35175858-35175880 GTGAAACCCTGGGATGAAAAGGG - Intronic
1146989631 17:37257020-37257042 CTAAAACATAGGGCTGAAGGAGG - Intronic
1148826329 17:50397045-50397067 GAAGAACCTTGGGCTGGACGCGG + Intronic
1152795982 17:82306676-82306698 TTAAAAGCTTGGGCTTAAATGGG + Intergenic
1155328134 18:24686606-24686628 CTAATACCTTGTGCTGAAGGTGG - Intergenic
1156675357 18:39521512-39521534 GTAAAACCTTGGTTTGAAGTGGG + Intergenic
1158891028 18:61871787-61871809 GTAAAACCTGAGACTAAAAGAGG - Intronic
1161188962 19:2942541-2942563 CTAAAACCTGGGGCTGAAATAGG + Intronic
1164032489 19:21419983-21420005 GTAAAACCTTGTCCTGGGAGAGG - Intronic
1164539952 19:29114941-29114963 GCAAAATCTTAGGCTTAAAGTGG + Intergenic
926624551 2:15080256-15080278 GTGAACTCTTGGGCTTAAAGGGG - Intergenic
930591261 2:53328991-53329013 GTTAAACCTTGGGGAGAAAAAGG - Intergenic
931114853 2:59153520-59153542 GTGAATCCTGGGGCTGGAAGGGG - Intergenic
931940661 2:67248352-67248374 TAAGAACCTAGGGCTGAAAGTGG - Intergenic
939107625 2:137967747-137967769 GTTAATACATGGGCTGAAAGAGG - Intronic
939319389 2:140597441-140597463 GTAAAACATTGTCCTGAATGTGG - Intronic
941444328 2:165582015-165582037 GAAAAACATTGGGTTGAACGGGG + Intronic
942908149 2:181208173-181208195 TTCAAGCCCTGGGCTGAAAGAGG + Intergenic
946666640 2:222057455-222057477 GTAGAATTTTGGGCAGAAAGAGG - Intergenic
947448714 2:230185219-230185241 TTAAAGCCTTGGCCTGAAAGTGG + Intronic
947701999 2:232242377-232242399 GCAAAGGCCTGGGCTGAAAGGGG + Intronic
1168800040 20:638767-638789 GTAAAAACTGAGGCTCAAAGAGG - Intergenic
1169578473 20:6992328-6992350 TTATAAGCTTGTGCTGAAAGGGG + Intergenic
1173360035 20:42335174-42335196 GTAAAATGTGGGGCTGAAAAGGG + Intronic
1176275185 20:64261867-64261889 GTAGAACCTTGGGGAGAAATAGG + Intronic
952220413 3:31318604-31318626 GCATGACCTTGGCCTGAAAGTGG - Intergenic
952622673 3:35364614-35364636 GTATACCCTTAGGCAGAAAGAGG - Intergenic
952724060 3:36563510-36563532 GCGAAACCTTGACCTGAAAGTGG - Intergenic
954531794 3:51327351-51327373 GTAGAAACTTGGGCTTAGAGAGG + Intronic
955315765 3:57937643-57937665 GTAGAACCCTGGTCTGAAGGTGG + Intergenic
956198221 3:66675167-66675189 GTGCATCCTTGGGCTGAAATAGG + Intergenic
957637981 3:82811671-82811693 GTAAAATCTTCCTCTGAAAGAGG + Intergenic
958981274 3:100723021-100723043 CTTAAACCTTGGGCTGTCAGGGG + Intronic
959631035 3:108507346-108507368 GGAAAGCCTTTGGCTGAAGGAGG + Intronic
960115483 3:113887784-113887806 GTAAAATTTAGGACTGAAAGTGG + Intronic
960396407 3:117142694-117142716 GCAGAACCTTGGGCAGATAGAGG + Intergenic
962154595 3:132932664-132932686 TTAAAACCTTGGTCTGATAGAGG + Intergenic
966740510 3:183228926-183228948 ATAAAACCTGGGGCTCAAAGAGG + Intronic
967681082 3:192364580-192364602 TAAAAACCTTGGCCTGAAAATGG - Intronic
974394279 4:61314734-61314756 GTCACAACTTGGGCTGAAGGTGG + Intronic
978296951 4:107216582-107216604 GTAACACATTGGACTAAAAGTGG - Intronic
980851965 4:138393921-138393943 GCAAAACCTTGGGTTCAAAAAGG + Intergenic
981610689 4:146590718-146590740 GCAAAACCATGGCCTGGAAGTGG + Intergenic
982567559 4:157005263-157005285 GTAAAAGCTTGGGCTGTTAGTGG + Intergenic
982738174 4:159028619-159028641 TTTAAAACTTGGGCTGAATGCGG - Intronic
986473635 5:8101065-8101087 GCAGAAACTTAGGCTGAAAGGGG + Intergenic
986495741 5:8340112-8340134 GCAGACCCTGGGGCTGAAAGGGG + Intergenic
987965640 5:24868644-24868666 GTTAAAAATAGGGCTGAAAGAGG + Intergenic
992084325 5:73264352-73264374 CTAAAACCATGGTCTGAAATGGG + Intergenic
1000052803 5:157576431-157576453 GAAAACCCTTGGGCTGCATGCGG + Intergenic
1001022888 5:168198637-168198659 GAAGAAACTTGGGCTGAGAGAGG + Intronic
1004084076 6:12426957-12426979 GAGAAACCTTGGGCTCAAAAAGG + Intergenic
1008497077 6:52144597-52144619 CTGAAACCTTGGGCTGAGCGAGG - Intergenic
1008905369 6:56671982-56672004 GTAAAACTTTAGACTGAAAAGGG - Intronic
1009868368 6:69426176-69426198 GTAAAATCTTGGGCTTAATATGG - Intergenic
1010597357 6:77780185-77780207 GTAAAAGATTTGGCTGAAGGCGG + Intronic
1012230086 6:96750850-96750872 GTAAACCCTGGGGCTGCTAGAGG + Intergenic
1012706037 6:102532309-102532331 ATAAAAACTTGAGCTCAAAGAGG + Intergenic
1017448750 6:154533795-154533817 GAAAAACCCAGGGATGAAAGAGG + Intergenic
1019392576 7:797147-797169 GGAAAACATTAAGCTGAAAGCGG - Intergenic
1020020663 7:4865769-4865791 GAAAAACCTTGTGGTGAAGGGGG - Intronic
1020486106 7:8722726-8722748 GGAAAACCTTGGAATGCAAGAGG + Intronic
1025799481 7:64772108-64772130 ATAAAACCTTGGGCTGGGCGCGG - Intergenic
1027471017 7:78574143-78574165 GTAAAACCTGGAGCTCAAAAAGG - Intronic
1028136144 7:87225062-87225084 GTAAAAACTGAGGCTGATAGGGG - Intergenic
1031599675 7:123691610-123691632 GTAAAACCTTGGGCTTATATAGG - Intronic
1034319282 7:150164647-150164669 GTAATAACTTGTGCTGGAAGAGG + Intergenic
1034773479 7:153802562-153802584 GTAATAACTTGTGCTGGAAGAGG - Intergenic
1037096579 8:14993537-14993559 GGAAATTCTTGGGCTGAAAGAGG + Intronic
1039677284 8:39683287-39683309 GTAAAACCTTCAGATGAAATTGG + Intronic
1043115788 8:76252274-76252296 GGAAGACCTAGAGCTGAAAGTGG + Intergenic
1045536173 8:103030311-103030333 TTAAAACATGGGGCTGAGAGAGG + Intronic
1047335608 8:123933011-123933033 GAAAAACCTGGGGCTCACAGAGG - Intronic
1055669772 9:78592464-78592486 GTAAAACCTTGAGATGGAAAAGG + Intergenic
1060138979 9:121188151-121188173 CTAAAACATTGGGGGGAAAGGGG - Intronic
1060468383 9:123928446-123928468 GTGAAACATTGGGATTAAAGAGG - Intronic
1188552295 X:31377471-31377493 ATAAAATCTTAGGTTGAAAGGGG - Intronic
1189196227 X:39155724-39155746 GTAAAACTTTGGGCTGGGCGTGG - Intergenic
1195050105 X:101089097-101089119 GTAAAACCTTGGGCTGAAAGGGG - Intronic
1196301966 X:114058255-114058277 GAAAAATCTTGGCCAGAAAGGGG + Intergenic
1199146030 X:144368181-144368203 GTACACCCTGGGGTTGAAAGGGG - Intergenic