ID: 1195050768

View in Genome Browser
Species Human (GRCh38)
Location X:101094681-101094703
Sequence ATCGTCATGACCCTTGTGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 78}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195050762_1195050768 14 Left 1195050762 X:101094644-101094666 CCGAAAAAGCATTGGTGCCCTTG 0: 1
1: 0
2: 0
3: 11
4: 109
Right 1195050768 X:101094681-101094703 ATCGTCATGACCCTTGTGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 78
1195050766_1195050768 -4 Left 1195050766 X:101094662-101094684 CCTTGAAGTGGCCTGTGGCATCG 0: 1
1: 0
2: 0
3: 14
4: 100
Right 1195050768 X:101094681-101094703 ATCGTCATGACCCTTGTGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 78
1195050759_1195050768 24 Left 1195050759 X:101094634-101094656 CCATTCTCCTCCGAAAAAGCATT 0: 1
1: 0
2: 0
3: 21
4: 178
Right 1195050768 X:101094681-101094703 ATCGTCATGACCCTTGTGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 78
1195050765_1195050768 -3 Left 1195050765 X:101094661-101094683 CCCTTGAAGTGGCCTGTGGCATC 0: 1
1: 0
2: 0
3: 9
4: 90
Right 1195050768 X:101094681-101094703 ATCGTCATGACCCTTGTGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 78
1195050761_1195050768 17 Left 1195050761 X:101094641-101094663 CCTCCGAAAAAGCATTGGTGCCC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1195050768 X:101094681-101094703 ATCGTCATGACCCTTGTGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195050768 Original CRISPR ATCGTCATGACCCTTGTGCC TGG Exonic
900921599 1:5675087-5675109 ATCCTCATGTCTCTTGTGCTAGG + Intergenic
901661132 1:10798548-10798570 ATCTCTAAGACCCTTGTGCCTGG + Intergenic
904646956 1:31974823-31974845 AGGGTCATGGCCCTTGTGCCTGG - Intergenic
907608469 1:55843357-55843379 ATAGTCAAGACCCTTCTGGCAGG + Intergenic
908816455 1:68040301-68040323 ATTGTGATGGCCTTTGTGCCAGG - Intergenic
910727955 1:90358692-90358714 ATAGTCACCTCCCTTGTGCCAGG + Intergenic
1063477705 10:6343315-6343337 ATGGTCCTGACGCTGGTGCCAGG + Intergenic
1069619687 10:69829214-69829236 ACCGTCATCACCCTTGTTCAGGG + Intronic
1069655663 10:70086137-70086159 ATAGGCATGAGCCCTGTGCCTGG + Intronic
1073956495 10:108877425-108877447 CTCTTCCTGCCCCTTGTGCCTGG - Intergenic
1081252978 11:40858416-40858438 ATAGGCATGAACCATGTGCCTGG - Intronic
1083440036 11:62670015-62670037 ACCACCATGGCCCTTGTGCCAGG - Exonic
1083814761 11:65126409-65126431 ATAGGCATGAGCCATGTGCCTGG + Exonic
1089158006 11:116416916-116416938 CTTGTCATTTCCCTTGTGCCTGG + Intergenic
1089531694 11:119134080-119134102 ATCTTCATGTTCCTTGTACCTGG - Exonic
1089712958 11:120330114-120330136 ATTATCATGGCCCTTGTGCTTGG + Exonic
1090986433 11:131770525-131770547 GTGGTCATAACCCTGGTGCCTGG - Intronic
1091217171 11:133909165-133909187 CTCGTCCTGACCCCTTTGCCCGG - Exonic
1094014536 12:25848806-25848828 ATAGGCATGACCACTGTGCCTGG - Intergenic
1097975849 12:65685110-65685132 ATAGGCATGACCACTGTGCCTGG - Intergenic
1118765884 14:68909118-68909140 AACTTCATTACCCTTGTGCGTGG - Intronic
1118765971 14:68909565-68909587 AAAGTCTTGACCCTAGTGCCTGG - Intronic
1119663983 14:76471223-76471245 ATGGTCATGACCCTGGTCCAAGG + Intronic
1202891455 14_KI270722v1_random:163060-163082 ATTGTCATGAACTTTGTGCAAGG - Intergenic
1126686039 15:51249885-51249907 AGTGTCATGACCCCAGTGCCAGG - Intronic
1130950069 15:88579186-88579208 ATAGGCATGAGCCCTGTGCCCGG + Intergenic
1131262173 15:90893173-90893195 ATCGTCATGGAGCTTGTGCAGGG + Exonic
1133508781 16:6437995-6438017 TTGGTCTTGACTCTTGTGCCAGG + Intronic
1133580152 16:7136938-7136960 CTCGTCATGGCCCATGGGCCAGG + Intronic
1141087435 16:81106568-81106590 ATCAGCATGACCCCTGTGCAAGG - Intergenic
1144482804 17:15641428-15641450 GTCTTCATGCCCCTTGTGCATGG + Intronic
1144915881 17:18723603-18723625 GTCTTCATGCCCCTTGTGCATGG - Intronic
1148925819 17:51084122-51084144 ATAGTCATGTTCCCTGTGCCTGG - Intronic
1157578019 18:48756735-48756757 ATTCTCATGACCCTTCTGGCTGG - Intronic
1158188905 18:54803324-54803346 AGCCTCATGCCCCTTCTGCCTGG - Intronic
1161831600 19:6609104-6609126 CTTGACATGACCCTTGTGCTAGG + Intergenic
1165484694 19:36088635-36088657 ATCCACATGAGCCTTGGGCCAGG - Intronic
927692781 2:25219900-25219922 AACTTCACAACCCTTGTGCCTGG - Intergenic
928043394 2:27901642-27901664 ATCTTCATTAGCCTTGTGTCTGG + Intronic
931582551 2:63792749-63792771 CTCATCATGGCCCTTGTGGCTGG + Intronic
935606134 2:104973821-104973843 ATCCTTATTTCCCTTGTGCCTGG - Intergenic
936006515 2:108893702-108893724 ATTGTCATGGCCTTTGTGCAAGG - Intergenic
946398889 2:219458263-219458285 AGCCTCATGACCCTTGTGGCTGG - Intronic
947631494 2:231656313-231656335 ATCTCCATGACCCTTGTGTCGGG + Intergenic
948827548 2:240580007-240580029 AGCGTCATGACCCTGGGGGCAGG + Exonic
948919966 2:241060664-241060686 ATAGGCATGAGCCATGTGCCCGG - Intronic
1169595642 20:7195207-7195229 ACAGTCATGAGCCATGTGCCTGG + Intergenic
1171773030 20:29341227-29341249 ATCCTCATGTCTCTTGTGCTAGG - Intergenic
1171903313 20:30877254-30877276 ATCCTCATGTCTCTTGTGCTAGG + Intergenic
1174288022 20:49485712-49485734 ACCATCATGACCCTTGTCCAAGG + Intergenic
1176256495 20:64155805-64155827 ATCGCCTTGACCCTGGTCCCTGG + Intronic
1180336711 22:11583212-11583234 ATCCTCATGTCTCTTGTGCTAGG + Intergenic
1181393776 22:22603624-22603646 CTGGTCATGCTCCTTGTGCCAGG - Intergenic
1185125697 22:49009557-49009579 ATTGGCATGAACCGTGTGCCAGG + Intergenic
949116518 3:332439-332461 ATCGTCATCACCTTTTTGTCAGG - Intronic
954619250 3:51986310-51986332 ATCCACATGACCTTTGTGCCTGG + Exonic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
961161448 3:124730312-124730334 ATCCACCTGACCCTTGAGCCCGG + Intergenic
961213468 3:125142507-125142529 ATCTTCAGGGTCCTTGTGCCTGG - Intronic
974100795 4:57414025-57414047 CTCCTCATGACCTTTCTGCCAGG + Intergenic
980782772 4:137513184-137513206 ATGATCATTTCCCTTGTGCCTGG + Intergenic
984588839 4:181593939-181593961 ATCTTAATGACCGTTGTGTCAGG - Intergenic
987143961 5:14973315-14973337 ATAGGCATGAACATTGTGCCTGG + Intergenic
990408283 5:55514100-55514122 ATAGGCATGAGCCATGTGCCTGG - Intronic
995885361 5:116888347-116888369 AGCGTCAAGACTCTGGTGCCTGG - Intergenic
998376769 5:141696156-141696178 ATGGGCACTACCCTTGTGCCCGG + Intergenic
1001216180 5:169858279-169858301 ATGGTAAGGTCCCTTGTGCCAGG + Intronic
1021960603 7:25869181-25869203 TTCCTCCTGACCTTTGTGCCAGG + Intergenic
1038534916 8:28347051-28347073 AACATCATGACCCTACTGCCAGG + Exonic
1041828196 8:62122562-62122584 CTCATCATGACCTTTGTACCTGG + Intergenic
1042471168 8:69189554-69189576 ATAGTCATGAGCATTGTACCAGG - Intergenic
1042786359 8:72551082-72551104 ATGGTCCTGTCCATTGTGCCTGG - Intronic
1044278545 8:90330026-90330048 ACAGTCATGAGCCATGTGCCCGG - Intergenic
1045977268 8:108143531-108143553 CTCCTCATGACCATTGTCCCCGG - Intergenic
1047981467 8:130187696-130187718 ATAGGCATGACCACTGTGCCTGG + Intronic
1049743356 8:144251616-144251638 GTCATCATGACCATTGTTCCTGG + Intronic
1056064593 9:82920912-82920934 AGCATCATGACCTTTCTGCCTGG - Intergenic
1059468043 9:114481845-114481867 GTCCTCATGACACTTATGCCTGG + Intronic
1195050768 X:101094681-101094703 ATCGTCATGACCCTTGTGCCTGG + Exonic
1200906890 Y:8492846-8492868 AATGATATGACCCTTGTGCCTGG + Intergenic
1202247636 Y:22836016-22836038 AGCATCATCACCTTTGTGCCTGG - Intergenic
1202400624 Y:24469764-24469786 AGCATCATCACCTTTGTGCCTGG - Intergenic
1202470156 Y:25200322-25200344 AGCATCATCACCTTTGTGCCTGG + Intergenic